Previous Contig 006732:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006A04Sequence460006732 (7)pir|T09781|T097816e-44glutathione transferase (EC 2.5.1.18) - papaya>gb:CPJ000923_1648642 Carica papay830006732 (7)pir|S19182|S191826e-67gene C-7 protein - common tobacco>gb:NTC7_1691495 N.tabacum mRNA C-7.
JMFF022P22Sequence141006732 (7)gb:AJ879067_18151283e-05Capsicum chinense mRNA for glutathione S-transferase/peroxidase.798006732 (7)pir|S19182|S191822e-66gene C-7 protein - common tobacco>gb:NTC7_1691495 N.tabacum mRNA C-7.
JMFS106H01Sequence598006732 (7)pir|S19182|S191824e-61gene C-7 protein - common tobacco>gb:NTC7_1691495 N.tabacum mRNA C-7.
JMSF031F21Sequence533006732 (7)pir|S19182|S191821e-45gene C-7 protein - common tobacco>gb:NTC7_1691495 N.tabacum mRNA C-7.683006732 (7)pir|S19182|S191822e-57gene C-7 protein - common tobacco>gb:NTC7_1691495 N.tabacum mRNA C-7.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022P22- ATAATATCCATTATATTTAATTTTGAGAATTATCATATTC
rJMSF031F21- AATTTTGAGAATTATCATATTC
rJMFF006A04- ATTTTATTACACAATAATATCCATTATATTTAATTTTGAGAATTATCATATTC
                      ____________________________________________________________
consensus ATTTTATTACACAATAATATCCATTATATTTAATTTTGAGAATTATCATATTC
 
. : . : . : . : . : . :
rJMFF022P22- TTCTTACATATGCTTAATTAATGCATCACAAAGTACATAATATGCTTATTTATGTATCTT
rJMSF031F21- TTCTTACATATGCTTAATTAATGCATCACAAAGTACATAATATGCTTATTTATGTATCTT
rJMFF006A04- TTCTTACATATGCTTAATTAATGCATCACAAAGTACATAATATGCTTATTTATGTATCTT
                      ____________________________________________________________
consensus TTCTTACATATGCTTAATTAATGCATCACAAAGTACATAATATGCTTATTTATGTATCTT
 
. : . : . : . : . : . :
rJMFF022P22- TATCTTTGATTTGCCTTGTTCCTTGGAGATGCTCTAAGCAACGCCAATCCTTTCCCACAT
rJMSF031F21- TATCTTTGATTTGCCTTGTTCCTTGGAGATGCTCTAAGCAACGCCAATCCTTTCCCACAT
rJMFF006A04- TATCTTTGATTTGCCTTGTTCCTTGGAGATGCTCTAAGCAACGCCAATCCTTTCCCACAT
                      ____________________________________________________________
consensus TATCTTTGATTTGCCTTGTTCCTTGGAGATGCTCTAAGCAACGCCAATCCTTTCCCACAT
 
. : . : . : . : . : . :
rJMFF022P22- CTGCAGAGTAAAGTCATAGACCTTCAAAGGGTCTGCAAGAGAGGTGGACACACTCTCATT
rJMSF031F21- CTGCAGAGTAAAGTCATAGACCTTCAAAGGGTCTGCAAGAGAGGTGGACACACTCTCATT
JMFS106H01+ AGAGGTGGACACACTCTCATT
rJMFF006A04- CTGCAGAGTAAAGTCATAGACCTTCAAAGGGTCTGCAAGAGAGGTGGACACACTCTCATT
                      ____________________________________________________________
consensus CTGCAGAGTAAAGTCATAGACCTTCAAAGGGTCTGCAAGAGAGGTGGACACACTCTCATT
 
. : . : . : . : . : . :
rJMFF022P22- TTGCATGCATCTTTTGCCCCATTCACTCAACTTTGGAATTTCTGCATCCATGATCAACTC
rJMSF031F21- TTGCATGCATCTTTTGCCCCATTCACTCAACTTTGGAATTTCTGCATCCATGATCAACTC
JMFS106H01+ TTGCATGCATCTTTTGCCCCATTCACTCAACTTTGGAATTTCTGCATCCATGATCAACTC
rJMFF006A04- TTGCATGCATCTTTTGCCCCATTCACTCAACTTTGGAATTTCTGCATCCATGATCAACTC
                      ____________________________________________________________
consensus TTGCATGCATCTTTTGCCCCATTCACTCAACTTTGGAATTTCTGCATCCATGATCAACTC
 
. : . : . : . : . : . :
rJMFF022P22- TACATCTTTCTCAAAAGTCAGCAGCCAAGTGTAGTATGAAACCAGAACCAAATCCAAGAA
rJMSF031F21- TACATCTTTCTCAAAAGTCAGCAGCCAAGTGTAGTATGAAACCAGAACCAAATCCAAGAA
JMFS106H01+ TACATCTTTCTCAAAAGTCAGCAGCCAAGTGTAGTATGAAACCAGAACCAAATCCAAGAA
rJMFF006A04- TACATCTTTCTCAAAAGTCAGCAGCCAAGTGTAGTATGAAACCAGAACCAAATCCAAGAA
JMSF031F21+ TCAAAAGTCAGCAGNCAAGNGTAGTANGAAACCAGAACCAAATCCAAGAA
                      ____________________________________________________________
consensus TACATCTTTCTCAAAAGTCAGCAGCCAAGTGTAGTATGAAACCAGAACCAAATCCAAGAA
 
. : . : . : . : . : . :
rJMFF022P22- CCCAAT-CCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
rJMSF031F21- CCCAAT-CCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
JMFS106H01+ CCCAAT-CCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
JMFF006A04+ CCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
rJMFF006A04- CCCAAT-CCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
JMSF031F21+ CCCAATCCCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
                      ____________________________________________________________
consensus CCCAAT-CCTCTCCCCTCCATAATATGCCTCTTCCCCTAACTCCCTTTCCAACACCTTCA
 
. : . : . : . : . : . :
rJMFF022P22- GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
rJMSF031F21- GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
JMFS106H01+ GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
JMFF006A04+ GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
rJMFF006A04- GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
JMSF031F21+ GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
                      ____________________________________________________________
consensus GGTTCTCCACCAGTTCTTCTTTAATGTCCTTTGTATCTTTGGTTTTAAACAGCCATGCCC
 
. : . : . : . : . : . :
rJMFF022P22- TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
rJMSF031F21- TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
JMFS106H01+ TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
JMFF006A04+ TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
rJMFF006A04- TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
JMSF031F21+ TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
                      ____________________________________________________________
consensus TTATACAGTCATAGATCTTTTTGTCAATGAAATCAGCCCAGAACCTAGCTTGAGCTCTCT
 
. : . : . : . : . : . :
rJMFF022P22- TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
rJMSF031F21- TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
JMFS106H01+ TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
JMFF006A04+ TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
rJMFF006A04- TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
JMSF031F21+ TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
                      ____________________________________________________________
consensus TGTAAGGATCCGAAGGCAACAATGGAAACTTGTCCTTCCAGACCTCATCGATGTACTCCA
 
. : . : . : . : . : . :
rJMFF022P22- GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
rJMSF031F21- GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
JMFS106H01+ GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
JMFF006A04+ GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
rJMFF006A04- GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
JMSF031F21+ GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
                      ____________________________________________________________
consensus GAATGATGAGAGACTCGCAGACGGGTTTTCCGTTGTGAATGAGAACAGGGACCTTCTTGT
 
. : . : . : . : . : . :
rJMFF022P22- GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
rJMSF031F21- GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAGGTCTTCCTCTTNGGATT
JMFS106H01+ GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
JMFF022P22+ TGTTCCTCAAGTCTTCCTCTTTGGATT
JMFF006A04+ GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
rJMFF006A04- GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
JMSF031F21+ GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
                      ____________________________________________________________
consensus GAACCGGGTTCATCTCCAGCAAGAGTGAGCTTTTGTTCCTCAAGTCTTCCTCTTTGGATT
 
. : . : . : . : . : . :
rJMFF022P22- CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
rJMSF031F21- CG
JMFS106H01+ CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
JMFF022P22+ CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
JMFF006A04+ CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
rJMFF006A04- CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
JMSF031F21+ CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
                      ____________________________________________________________
consensus CGTAGTGAACCCCTTTGAGAGCGAGCGCCATTTTTGGCCTCATCGCGAACATGCTCACGT
 
. : . : . : . : . : . :
rJMFF022P22- GTAAATCCNATATAACAACCTTATCATCACCATCACTAG
JMFS106H01+ GTAAATCCAATATAACAACCTTATCATCACCATCACTA
JMFF022P22+ GTAAATCCAATATAACAACCTTATCATCACCATCACTAGCCATCTTTG
JMFF006A04+ GTAAATCCAATATAACAACCTTATCATCACCATCACTAGCCATCTTTG
rJMFF006A04- GTAAATCCAATATAACAACCTTATCATCACCATCACTAGCCATCTTTG
JMSF031F21+ GTAAATCCAATATAACAACCTTATCATCACCATCACTAGCCATCTTTGTGTTTCAATTCC
                      ____________________________________________________________
consensus GTAAATCCAATATAACAACCTTATCATCACCATCACTAGCCATCTTTGTGTTTCAATTCC