Previous Contig 006730:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006O18Sequence602006730 (6)gb:AP005523_18534182e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048397006730 (6)gb:AP005523_18534182e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048
JMFN003D20Sequence587006730 (6)gb:AK117947_18159545e-29Arabidopsis thaliana At5g38660 mRNA for unknown protein, complete cds, clone: RA
JMSF025I03Sequence687019390pir|F96700|F967004e-48protein F12A21.9 [imported] - Arabidopsis thaliana>gb:AE005173_894399 Arabidopsi759006730 (6)gb:AY093763_15754227e-16Arabidopsis thaliana AT5g38690/MBB18_24 mRNA, complete cds.>gb:BT000824_1635079
JMSF031F09Sequence670006730 (6)gb:AP005523_18534181e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048758006730 (6)gb:AP005523_18534184e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025I03+ AAGAGGAGGAAAAGCGTTGAAGCAGAAACTACAGGATAACATTGCTGAAGCAGTCATTTC
                      ____________________________________________________________
consensus AAGAGGAGGAAAAGCGTTGAAGCAGAAACTACAGGATAACATTGCTGAAGCAGTCATTTC
 
. : . : . : . : . : . :
rJMSF025I03+ AAAGAATGGTGCTCCCATTACAGTATCGGGAGCATGATGCCATTGTTGCTAAAGTTAAGC
                      ____________________________________________________________
consensus AAAGAATGGTGCTCCCATTACAGTATCGGGAGCATGATGCCATTGTTGCTAAAGTTAAGC
 
. : . : . : . : . : . :
rJMSF025I03+ TTGAGACAGCAGAAGCTCATGCTGCATTGCTGGAGTCCAAAGGCTTATGGTTAAAATGTA
                      ____________________________________________________________
consensus TTGAGACAGCAGAAGCTCATGCTGCATTGCTGGAGTCCAAAGGCTTATGGTTAAAATGTA
 
. : . : . : . : . : . :
rJMSF025I03+ ATCAAAACGCTGATGCTGTTAGAACAGAGCCCATCTATGTGGACACCAATGGTCAGGTGC
                      ____________________________________________________________
consensus ATCAAAACGCTGATGCTGTTAGAACAGAGCCCATCTATGTGGACACCAATGGTCAGGTGC
 
. : . : . : . : . : . :
rJMSF025I03+ TGTGGAGATTGAAAAGCTACTCTGAGAAATCTGAAATACTACTTCAAGAGGTTGGAACTG
                      ____________________________________________________________
consensus TGTGGAGATTGAAAAGCTACTCTGAGAAATCTGAAATACTACTTCAAGAGGTTGGAACTG
 
. : . : . : . : . : . :
rJMSF025I03+ GGGATGATGCATCACATGAAAAATGGTCTACTTTTGATGTGGAACAGAAAGAAATAGTTG
                      ____________________________________________________________
consensus GGGATGATGCATCACATGAAAAATGGTCTACTTTTGATGTGGAACAGAAAGAAATAGTTG
 
. : . : . : . : . : . :
rJMSF025I03+ AGAAGCGGATTGACTCTTTGAGGCACAAAAGGATCAGGGTTCCAGGGAAACCTCCATTGC
                      ____________________________________________________________
consensus AGAAGCGGATTGACTCTTTGAGGCACAAAAGGATCAGGGTTCCAGGGAAACCTCCATTGC
 
. : . : . : . : . : . :
rJMSF025I03+ AGAGCAATGAAAGCTGAGCAGTAGTAATTCATCAAGATTAGTGCTGTGATACAGAGCCTC
                      ____________________________________________________________
consensus AGAGCAATGAAAGCTGAGCAGTAGTAATTCATCAAGATTAGTGCTGTGATACAGAGCCTC
 
. : . : . : . : . : . :
rJMSF025I03+ AAGGAGCACAAGTGTAGAACTTATGTAGCATAGCTTCATTAGCATTTTTGCAAACATATA
                      ____________________________________________________________
consensus AAGGAGCACAAGTGTAGAACTTATGTAGCATAGCTTCATTAGCATTTTTGCAAACATATA
 
. : . : . : . : . : . :
rJMSF025I03+ CATTCAATGTTTTTGCCATTGAATTGAATGTAGGCAGTGAACCTTGTAAAAAGCAGGTCT
                      ____________________________________________________________
consensus CATTCAATGTTTTTGCCATTGAATTGAATGTAGGCAGTGAACCTTGTAAAAAGCAGGTCT
 
. : . : . : . : . : . :
rJMSF025I03+ GTAAATCTGTTGTATCAAGGCAGACCCAGATTATATGAATGCCTTAAAATTAATCCTTTT
                      ____________________________________________________________
consensus GTAAATCTGTTGTATCAAGGCAGACCCAGATTATATGAATGCCTTAAAATTAATCCTTTT
 
. : . : . : . : . : . :
rJMSF025I03+ CGTTGATTCTCTGTTGAAAATTTTTTACAAGCTTCCTTTTGCTATACATGGCTAAACAAC
rJMSF031F09- AATTTTTTACAAGCTTCCTTTTGCTATACATGGCTAAACAAC
                      ____________________________________________________________
consensus CGTTGATTCTCTGTTGAAAATTTTTTACAAGCTTCCTTTTGCTATACATGGCTAAACAAC
 
. : . : . : . : . : . :
rJMSF025I03+ AGTTTACTATACTACATGAGCTCTTCCATTGTTGAGGAT
rJMFF006O18- TGCTANTTACNATGTT
rJMSF031F09- AGTTTACTATACTACATGAGCTCTTCCATTGTTGAGGATGTTCATGCTACTTACAATGTT
                      ____________________________________________________________
consensus AGTTTACTATACTACATGAGCTCTTCCATTGTTGAGGATGTTCATGCTACTTACAATGTT
 
. : . : . : . : . : . :
rJMFF006O18- GNGTTGGAAATTANTCNGACTTCNTACAAGTANTCTTTGTCTCCCTTANCAATTTCANAT
rJMSF031F09- GTGTTGGAAATTAGTCGGACTTCATACAAGTAGTCTTTGTCTCCCTTAACAATTTCAGAT
                      ____________________________________________________________
consensus GTGTTGGAAATTAGTCGGACTTCATACAAGTAGTCTTTGTCTCCCTTAACAATTTCAGAT
 
. : . : . : . : . : . :
rJMFF006O18- GAAATTCCTGGACNAAAGAAGGAAGNAAATTTTTCCCGNCTTTTTTCAAAATCTGANAGC
rJMSF031F09- GAAATTCCTGGACCAAAGAAGGAAGCAAATTTTTCCCGTCTTTTTTCAAAATCTGAGAGC
                      ____________________________________________________________
consensus GAAATTCCTGGACCAAAGAAGGAAGCAAATTTTTCCCGTCTTTTTTCAAAATCTGAGAGC
 
. : . : . : . : . : . :
rJMFF006O18- TCCNAAGCTTTGGCCTCNAACACCAACACTANACAGNATTTACCATCTTCCGTAACCTCT
rJMSF031F09- TCCAAAGCTTTGGCCTCGAACACCAACACTAGACAGTATTTACCATCTTCCGTAACCTCT
                      ____________________________________________________________
consensus TCCAAAGCTTTGGCCTCGAACACCAACACTAGACAGTATTTACCATCTTCCGTAACCTCT
 
. : . : . : . : . : . :
rJMFF006O18- TCNCGGATCATTTGCNAAATGGGAGCACTCCTCCGTGCAATTCCTCCACCCTGGCCNTAT
rJMSF031F09- TCGCGGATCATTTGCAAAATGGGAGCACTCCTCCGTGCAATTCCTCCACCCTGGCCATAT
                      ____________________________________________________________
consensus TCGCGGATCATTTGCAAAATGGGAGCACTCCTCCGTGCAATTCCTCCACCCTGGCCATAT
 
. : . : . : . : . : . :
rJMFF006O18- TGGAANATACNTNTCAATGCCTNATCCAAATGTTGNTCATCTCCNTAACGGAACCTTGTC
rJMSF031F09- TGGAAAATACGTTTCAATGCCTCATCCAAATGTTGCTCATCTCCATAACGGAACCTTGTC
JMFN003D20+ GTC
JMFF006O18+ GTC
JMSF031F09+ TCAATGCCTCATCCAAATGTTGCTCATCTCCATAACGGAACCTTGTC
                      ____________________________________________________________
consensus TGGAAAATACGTTTCAATGCCTCATCCAAATGTTGCTCATCTCCATAACGGAACCTTGTC
 
. : . : . : . : . : . :
rJMFF006O18- ACATCACTCTTGACCTGTTTAAGGATTGNAGNAACACACTTTTCCCTTANCATTTGAGCA
rJMSF031F09- ACATCACTCTTGACCTGTTTAAGGATTGGAGTAGCACACTTTTCCCTTAACATTTGAGCA
JMFN003D20+ ACATCACTCTTGACCTGTTTAAGGATTGGAGTAGCACACTTTTCCCTTAACATTTGAGCA
JMFF006O18+ ACATCACTCTTGACCTGTTTAAGGATTGGAGTAGCACACTTTTCCCTTAACATTTGAGCA
JMSF031F09+ ACATCACTCTTGACCTGTTTAAGGATTGGAGTAGCACACTTTTCCCTTAACATTTGAGCA
                      ____________________________________________________________
consensus ACATCACTCTTGACCTGTTTAAGGATTGGAGTAGCACACTTTTCCCTTAACATTTGAGCA
 
. : . : . : . : . : . :
rJMFF006O18- TCTGAATANGTCACACATGGT
rJMSF031F09- TCTGAATAGGTCACACATGGTACTGGTTTAAGCTCTGCATACTTGAGGGCCATGCCAATT
JMFN003D20+ TCTGAATAGGTCACACATGGTACTGGTTTAAGCTCTGCATACTTGAGGGCCATGCCAATT
JMFF006O18+ TNTGAATAGGTCACACATGGTACTGGTTTAAGCTNTGCATACTTGAGGGCCATGCCAATT
JMSF031F09+ TCTGAATAGGTCACACATGGTACTGGTTTAAGCTCTGCATACTTGAGGGCCATGCCAATT
                      ____________________________________________________________
consensus TCTGAATAGGTCACACATGGTACTGGTTTAAGCTCTGCATACTTGAGGGCCATGCCAATT
 
. : . : . : . : . : . :
rJMSF031F09- ATAGCAAGAGGAAAGCCATATGTAAGCATCAATGCAGACCACTCAGATCCAGGAATGATA
JMFN003D20+ ATAGCAAGAGGAAAGCCATATGTAAGCATCAATGCAGACCACTCAGATCCAGGAATGATA
JMFF006O18+ ATAGCAAGAGGAAAGCCATATGTAAGCATCAATGCAGACCACTCAGATCCAGGAATGATA
JMSF031F09+ ATAGCAAGAGGAAAGCCATATGTAAGCATCAATGCAGACCACTCAGATCCAGGAATGATA
                      ____________________________________________________________
consensus ATAGCAAGAGGAAAGCCATATGTAAGCATCAATGCAGACCACTCAGATCCAGGAATGATA
 
. : . : . : . : . : . :
rJMSF031F09- TTAAAGTATGCTCCAAAACCATACGAGAGAAGTGAAACCCCCACA-CCAAGTCCAACAAC
JMFN003D20+ TTAAAGTATGCTCCAAAACCATACGAGAGAAGTGAAACCCCCACA-CCAAGTCCAACAAC
JMFF006O18+ TTAAAGTATGCTCCAAAACCATACGAGAGAAGTGAAACCCCCACACCCAAGTCCAACAAC
JMSF031F09+ TTAAAGTATGCTCCAAAACCATACGAGAGAAGTGAAACCCCCACA-CCAAGTCCAACAAC
                      ____________________________________________________________
consensus TTAAAGTATGCTCCAAAACCATACGAGAGAAGTGAAACCCCCACA-CCAAGTCCAACAAC
 
. : . : . : . : . : . :
rJMSF031F09- ACCAAATGAAATCTTGGAAAGGGAAAATCCATCATCGTTAACGACGGACTTGTCGGAAGA
JMFN003D20+ ACCAAATGAAATCTTGGAAAGGGAAAATCCATCATCGTTAACGACGGACTTGTCGGAAGA
JMFF006O18+ ACCAAATGAAATCTTGGAAAGGGAAAATCCATCATCGTTAACGACGGACTTGTCGGAAGA
JMSF031F09+ ACCAAATGAAATCTTGGAAAGGGAAAATCCATCATCGTTAACGACGGACTTGTCGGAAGA
                      ____________________________________________________________
consensus ACCAAATGAAATCTTGGAAAGGGAAAATCCATCATCGTTAACGACGGACTTGTCGGAAGA
 
. : . : . : . : . : . :
rJMSF031F09- AGTAACGGAGGAAGGCTGAGTCTGAGTTG-ATCAGCAGCTCCGCAGACTATTT
JMFN003D20+ AGTAACGGAGGAAGGCTGAGTCTGAGTTGAATCAGCAGCTCCGCAGACTATTTTAAGCCG
JMFF006O18+ AGTAACGGAGGAAGGCTGAGTCTGAGTTGAATCAGCAGCTCCGCAGACTATTTTAAGCCG
JMSF031F09+ AGTAACGGAGGAAGGCTGAGTCTGAGTTGAATCAGCAGCTCCGCAGACTATTTTAAGCCG
                      ____________________________________________________________
consensus AGTAACGGAGGAAGGCTGAGTCTGAGTTGAATCAGCAGCTCCGCAGACTATTTTAAGCCG
 
. : . : . : . : . : . :
JMFN003D20+ GCGCGGATTCGCCAAAAGCGATCGTCGAGCAATGGAAGCCGCCGACCTGAACTTGCGCGT
JMFF006O18+ GCGCGGATTCGCCAAAAGCGATCGTCGAGCAATGGAAGCCGCCGACCTGAACTTGCGCGT
JMSF031F09+ GCGCGGATTCGCCAAAAGCGATCGTCGAGCAATGGAAGCCGCCGACCTGAACTTGCGCGT
                      ____________________________________________________________
consensus GCGCGGATTCGCCAAAAGCGATCGTCGAGCAATGGAAGCCGCCGACCTGAACTTGCGCGT
 
. : . : . : . : . : . :
JMFN003D20+ GGAGGACAGAGATTGGTTTCGACTCAGAGAGAGTAAATGCGCGCGGTTACAAACCGCAAA
JMFF006O18+ GGAGGACAGAGATTGGTTTCGACTCAGAGAGAGTAAATGCGCGCGGTTACAAACCGCAAA
JMSF031F09+ GGAGGACAGAGATTGGTTTCGACTCAGAGAGAGTAAATGCGCGCGGTTACAAACCGCAAA
                      ____________________________________________________________
consensus GGAGGACAGAGATTGGTTTCGACTCAGAGAGAGTAAATGCGCGCGGTTACAAACCGCAAA
 
. : . : . : . : . : . :
JMFN003D20+ ACGCGGCGGCGAACAGAGGATGGTTCCGCCGCTTCCTCCCGACATGGCCACAGCTGCTTT
JMFF006O18+ ACGCGGCGGCGAACAGAGGATGGTTCCGCCGCTTCCTCCCGACATGGCCACAGCTGCTTT
JMSF031F09+ ACGCGGCGGCGAACAGAGGATGGTTCCGCCGCTTCCTCCCGACATGGCCACAGCTGCTTT
                      ____________________________________________________________
consensus ACGCGGCGGCGAACAGAGGATGGTTCCGCCGCTTCCTCCCGACATGGCCACAGCTGCTTT
 
. : . : . : . : . : . :
JMFN003D20+ CATCTCTCTCCGGTGATAATTCCGTTGAGGGAGAAGAAGAGGTTT
JMFF006O18+ CATCTCTCTCCGGTGATAATTCCGTTGAGGGAGAAGAAGAGGTTTTACGAGGGCACGGC
JMSF031F09+ CATCTCTCTCCGGTGATAATTCCGTTGAGGGAGAAGAAGAGGTTTTACGAGGGCACGGCC
                      ____________________________________________________________
consensus CATCTCTCTCCGGTGATAATTCCGTTGAGGGAGAAGAAGAGGTTTTACGAGGGCACGGCC