Previous Contig 006729:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A20Sequence564006729 (28)gb:AF528526_18085602e-87Glycine max 40S ribosomal S4 protein mRNA, complete cds.530009352 (16)gb:AF528526_18085604e-52Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF006D03Sequence576006729 (28)gb:AF528526_18085604e-89Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF008P05Sequence564006729 (28)gb:AF528526_18085606e-82Glycine max 40S ribosomal S4 protein mRNA, complete cds.766009352 (16)gb:AF528526_18085604e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF016H06Sequence558006729 (28)gb:AF528526_18085601e-87Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF020L19Sequence575006729 (28)gb:AF528526_18085601e-88Glycine max 40S ribosomal S4 protein mRNA, complete cds.748006729 (28)gb:AF528526_18085602e-80Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF024I14Sequence414006729 (28)gb:AF528526_18085603e-59Glycine max 40S ribosomal S4 protein mRNA, complete cds.778009352 (16)gb:AF528526_18085609e-68Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF025J24Sequence562006729 (28)gb:AF528526_18085601e-88Glycine max 40S ribosomal S4 protein mRNA, complete cds.755009352 (16)gb:AF528526_18085603e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF026E04Sequence562006729 (28)gb:AF528526_18085601e-88Glycine max 40S ribosomal S4 protein mRNA, complete cds.533009352 (16)gb:AF528526_18085609e-52Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF026E15Sequence599006729 (28)gb:AF528526_18085607e-95Glycine max 40S ribosomal S4 protein mRNA, complete cds.286009352 (16)sp|P46299|RS4_GOSHI1e-1540S ribosomal protein S4.>pir|S45026|S45026 ribosomal protein S4, cytosolic - up
JMFF031F21Sequence629006729 (28)gb:AY086206_15712612e-99Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar715006729 (28)gb:AF528526_18085601e-69Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF039L13Sequence317006729 (28)gb:AP004851_18459744e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13662009352 (16)gb:AF528526_18085602e-66Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF042P10Sequence635006729 (28)gb:AF528526_1808560e-100Glycine max 40S ribosomal S4 protein mRNA, complete cds.600009352 (16)gb:AF528526_18085606e-54Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF043E04Sequence646001937 (60)gb:AF141642_17715871e-86Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1 (PIP2-1) mRNA, com599006729 (28)gb:AF528526_18085601e-42Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF047C07Sequence472006729 (28)gb:AY086206_15712611e-69Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar386009352 (16)gb:AF528526_18085603e-19Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMFF047I08Sequence397006729 (28)gb:AY525608_16116226e-57Zea mays ribosomal protein S4 mRNA, complete cds.
JMFF048G06Sequence227006729 (28)gb:AY086206_15712611e-21Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar
JMFN039C07Sequence627006729 (28)gb:AF528526_18085601e-98Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF014G02Sequence255006729 (28)gb:AY086206_15712611e-29Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar794009352 (16)gb:AF528526_18085602e-99Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF018E18Sequence525006729 (28)gb:AF528526_18085602e-82Glycine max 40S ribosomal S4 protein mRNA, complete cds.780009352 (16)gb:AF528526_18085603e-93Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF018N08Sequence467006729 (28)gb:AF528526_18085602e-68Glycine max 40S ribosomal S4 protein mRNA, complete cds.767009352 (16)gb:AF528526_18085606e-93Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF031F04Sequence639006729 (28)gb:AF528526_1808560e-100Glycine max 40S ribosomal S4 protein mRNA, complete cds.719009352 (16)gb:AF528526_18085607e-96Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF035H20Sequence638006729 (28)gb:AF528526_1808560e-101Glycine max 40S ribosomal S4 protein mRNA, complete cds.739009352 (16)gb:AF528526_18085604e-91Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF041N17Sequence768006729 (28)gb:AY086206_1571261e-112Arabidopsis thaliana clone 22434 mRNA, complete sequence.>gb:AF428285_1799215 Ar802006729 (28)gb:AF528526_18085603e-94Glycine max 40S ribosomal S4 protein mRNA, complete cds.
JMSF042G19Sequence760006729 (28)gb:AF528526_1808560e-112Glycine max 40S ribosomal S4 protein mRNA, complete cds.604023984gb:AP005730_18567582e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF044G19Sequence738006729 (28)gb:AF528526_1808560e-108Glycine max 40S ribosomal S4 protein mRNA, complete cds.641009352 (16)gb:AF528526_18085604e-71Glycine max 40S ribosomal S4 protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041N17- ATAGGAATT
                      ____________________________________________________________
consensus ATAGGAATT
 
. : . : . : . : . : . :
rJMFF020L19- A
rJMFF031F21- A
rJMSF041N17- CGGAAAACAGGACAGAATTACACATTAAAATAATAAATCTATTGCTAACAAAAAGTAAAA
                      ____________________________________________________________
consensus CGGAAAACAGGACAGAATTACACATTAAAATAATAAATCTATTGCTAACAAAAAGTAAAA
 
. : . : . : . : . : . :
rJMFF020L19- TTAGTTCAACCTGCAAAACAAAATTCTATCAAACTCTAATTACTTCAAAGCAGATATGGG
rJMFF031F21- TTAGTTCAACCTGCAAAACAAAATTCTATCAAACTCTAATTACTTCAAAGCAGATATGGG
rJMSF041N17- TTAGTTCAACCTGCAAAACAAAATTCTATCAAACTCTAATTACTTCAAAGCAGATATGGG
                      ____________________________________________________________
consensus TTAGTTCAACCTGCAAAACAAAATTCTATCAAACTCTAATTACTTCAAAGCAGATATGGG
 
. : . : . : . : . : . :
rJMFF043E04- TTTAAGCAGTGATTGCAGACTGAGCAGCAAGCCTC
rJMFF020L19- GTATTGGAAGAAAGCCTACAGTGCATTTAAGCAGTGATTGCAGACTGAGCAGCAAGCCTC
rJMFF031F21- GTATTGGAAGAAAGCCTACAGTGCATTTAAGCAGTGATTGCAGACTGAGCAGCAAGCCTC
rJMSF041N17- GTATTGGAAGAAAGCCTACAGTGCATTTAAGCAGTGATTGCAGACTGAGCAGCAAGCCTC
                      ____________________________________________________________
consensus GTATTGGAAGAAAGCCTACAGTGCATTTAAGCAGTGATTGCAGACTGAGCAGCAAGCCTC
 
. : . : . : . : . : . :
rJMFF043E04- TTCTTTGCCTCTTCGATGATGGAGAGCTTGATACCCTTACCCTTGGGAAGAGAAACCCAT
rJMFF020L19- TTCTTTGCCTCTTCGATGATGGAGAGCTTGATACCCTTACCCTTGGGAAGAGAAACCCAT
rJMFF031F21- TTCTTTGCCTCTTCGATGATGGAGAGCTTGATACCCTTACCCTTGGGAAGAGAAACCCAT
rJMSF041N17- TTCTTTGCCTCTTCGATGATGGAGAGCTTGATACCCTTACCCTTGGGAAGAGAAACCCAT
                      ____________________________________________________________
consensus TTCTTTGCCTCTTCGATGATGGAGAGCTTGATACCCTTACCCTTGGGAAGAGAAACCCAT
 
. : . : . : . : . : . :
rJMFF043E04- GGCTTGGTGCCTTTTCCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
rJMFF020L19- GGCTTGGTGCCTTTTCCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
rJMFF031F21- GGCTTGGTGCCTTTTCCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
rJMSF041N17- GGCTTGGTGCCTTTTCCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
JMFF031F21+ CCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
JMSF041N17+ AATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
JMSF042G19+ AATAGTGAACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
JMSF044G19+ AAACGAGTAGCAAACTCATGCCCA
                      ____________________________________________________________
consensus GGCTTGGTGCCTTTTCCAATAGTGTACACATTCCCCAAACGAGTAGCAAACTCATGCCCA
 
. : . : . : . : . : . :
rJMFF043E04- GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
rJMFF020L19- GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
rJMFF031F21- GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
rJMSF041N17- GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
JMFF031F21+ GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
JMSF041N17+ GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
JMFN039C07+ AAGCTTCCCTTATGCTTCTCCCTATTCTTGATG
JMSF042G19+ GTGGCATCCTGGATGTGGACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGATG
JMSF044G19+ GTGGCATCCTGGATGTGGACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGATG
                      ____________________________________________________________
consensus GTGGCATCCTGGATGTGAACAGTCTCGAAGCTTCCCTTATGCTTCTCCCTATTCTTGAGG
 
. : . : . : . : . : . :
rJMFF043E04- ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCCNACGTC-AA
rJMFF020L19- ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
rJMFF031F21- ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
rJMSF041N17- ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMFF031F21+ ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMSF041N17+ ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMFN039C07+ ACGCCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMSF042G19+ ACGCCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMFF042P10+ TTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMSF044G19+ ACGCCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMFF026E15+ CC-ACGTCAAA
JMSF035H20+ TTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
JMSF031F04+ TTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
                      ____________________________________________________________
consensus ACACCAACACGTCCCCTGTTTCTTCCACCAGTGACCATAACAACATTCCCC-ACGTCAAA
 
. : . : . : . : . : . :
rJMFF043E04- CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
rJMFF020L19- CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
rJMFF031F21- CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
rJMSF041N17- CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF031F21+ CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF006D03+ CTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF020L19+ CAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMSF041N17+ CTTGATGAAGTCAACAACCTTGTTGCTCTCCAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFN039C07+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMSF042G19+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF042P10+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTNTACTGTGTCATTAGCCTT
JMSF044G19+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF026E15+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF016H06+ GGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF001A20+ GGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF008P05+ GGTCCAGCTTTACTGTGTCATTAGCCTT
JMSF035H20+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF026E04+ CTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMFF025J24+ CTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
JMSF031F04+ CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
                      ____________________________________________________________
consensus CTTGATGAAGTCAACAACCTTGTTGCTCTCTAGGTCCAGCTTTACTGTGTCATTAGCCTT
 
. : . : . : . : . : . :
rJMFF043E04- GATGAGAGGATCAGGGTAGCGGAT
rJMFF020L19- GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
rJMFF031F21- GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
rJMSF041N17- GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF031F21+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF006D03+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF020L19+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF041N17+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFN039C07+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF042G19+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF042P10+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF044G19+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF026E15+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF016H06+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF018E18+ ATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF001A20+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF008P05+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF035H20+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF026E04+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMFF025J24+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
JMSF031F04+ GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
                      ____________________________________________________________
consensus GATGAGAGGATCAGGGTAGCGGATGGTTCTACCATCATAGGTGTTGATGAATGGAATTCC
 
. : . : . : . : . : . :
rJMFF020L19- CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
rJMFF031F21- CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
rJMSF041N17- CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
JMFF031F21+ CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
JMFF006D03+ CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
JMFF020L19+ CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
JMSF041N17+ CTTCTTTCCAAACTGGACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCGTCCCT
JMFN039C07+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMSF042G19+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF042P10+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMSF044G19+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF026E15+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF016H06+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMSF018E18+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF001A20+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF008P05+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMSF018N08+ AAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMSF035H20+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF026E04+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF025J24+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
JMFF047C07+ TTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCNT
JMSF031F04+ CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
                      ____________________________________________________________
consensus CTTCTTTCCAAACTGAACAGAGCGGACTTTGCAAAGCTTAAACTTAGCCTCCTCATCCCT
 
. : . : . : . : . : . :
rJMFF020L19- GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAAGGAGGCGGAAGTTCTCATTTG
rJMFF031F21- GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGA
rJMSF041N17- GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAG-GAGGCGGAAGTTCTCATTTG
JMFF031F21+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAG-GAGGCGGAAGTTCTCATTTG
JMFF006D03+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAG-GAGGCGGAAGTTCTCATTTG
JMFF020L19+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAG-GAGGCGGAAGTTCTCATTTG
JMSF041N17+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAG-GAGGCGGAAGTTCTCATTTG
JMFN039C07+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF042G19+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF042P10+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF044G19+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF026E15+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF016H06+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF018E18+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF047I08+ CGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF001A20+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF008P05+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF018N08+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GGGGCGGAAGTTCTCATTTG
JMFF024I14+ TGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF035H20+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF026E04+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF025J24+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMFF047C07+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
JMSF031F04+ GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
                      ____________________________________________________________
consensus GATTGAGTGAAGTCGGAATCGCCCTTTGGTATCATAGAA-GAGGCGGAAGTTCTCATTTG
 
. : . : . : . : . : . :
rJMFF020L19- TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGAC
rJMSF041N17- TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGACCT
JMFF031F21+ TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGACCT
JMFF006D03+ TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGACCT
JMFF020L19+ TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGACCT
JMSF041N17+ TCTTTGGAATTGATATAACATCCATGAAACCAGCAGGGTAAGTCTTGTCTGTCCTGACCT
JMFN039C07+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMSF042G19+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF042P10+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMSF044G19+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF026E15+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF016H06+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMSF018E18+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF047I08+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF039L13+ AGGGTAAGTCTTGTCAGTCCTGACCT
JMFF001A20+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF008P05+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTT-TCAGTCCTGACCT
JMSF018N08+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF024I14+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMSF035H20+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF026E04+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF025J24+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMFF047C07+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
JMSF031F04+ TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
                      ____________________________________________________________
consensus TCTTTGGAATTGAAACAACATCCATGAAACCAGCAGGGTAAGTCTTGTCAGTCCTGACCT
 
. : . : . : . : . : . :
rJMSF041N17- TACCATCAACC-AAACATGTCGCTGCATTAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF031F21+ TACCATCAACCAAAACATGTCGCTGCATTAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF006D03+ TACCATCAACCAAAACATGTCGCTGCATTAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF020L19+ TACCATCAACCAAAACATGTCGCTGCATTAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF041N17+ TACCATCAACCAAAACATGTCGCTGCATTAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFN039C07+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF042G19+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF042P10+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF044G19+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF026E15+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF016H06+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF018E18+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF047I08+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF039L13+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF014G02+ AAATGACTTCACGATAGGTAAGGG
JMFF001A20+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF008P05+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF018N08+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF024I14+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF035H20+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF026E04+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF025J24+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMFF047C07+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
JMSF031F04+ TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
                      ____________________________________________________________
consensus TACCATCAACCAAAACATGTCGCTGCATCAAAATTGAAATGACTTCACGATAGGTAAGGG
 
. : . : . : . : . : . :
rJMSF041N17- CATACTTCAACCTG
JMFF031F21+ CATACTTCAACCTGTTTCGAATGATAAGCACCAATGGCAAGCACTCCCTGGATTTGTGTG
JMFF006D03+ CATACTTCAACCTGTTTCGAATGATAAGCACCAATGGCAAGCACTCCCTGGATTTGTGTG
JMFF020L19+ CATACTTCAACCTGTTTCGAATGATAAGCACCAATGGCAAGCACTCCCTGGATTTGTGTG
JMSF041N17+ CATACTTCAACCTGTTTCGAATGATAAGCACCAATGGCAAGCACTCCCTGGATTTGTGTG
JMFN039C07+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF042G19+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF042P10+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF044G19+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF026E15+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF016H06+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF018E18+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF047I08+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF039L13+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF014G02+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF001A20+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF008P05+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF018N08+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF024I14+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF035H20+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF026E04+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF025J24+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF047C07+ CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMFF048G06+ TGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
JMSF031F04+ AATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
                      ____________________________________________________________
consensus CATACTTCAACCTGTTTCGAATGATAAGTACTAATGGCAAGCACTCCCTGGATTTGTGCG
 
. : . : . : . : . : . :
JMFF031F21+ GCCCAGAAGAAGGTTTAGGAGCAAATGCCCCACCCAACTTGCCCAG
JMFF006D03+ GCCCAGAAGAAGGTTTAGGAGCAAATGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF020L19+ GCCCAGAAGAAGGTTTAGGAGCAAATGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF041N17+ GCCCAGAAGAAGGTTTAGGAGCAAATGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFN039C07+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF042G19+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF042P10+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF044G19+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF026E15+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF016H06+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF018E18+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF047I08+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF039L13+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF014G02+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF001A20+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF008P05+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF018N08+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF024I14+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMSF035H20+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF026E04+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF025J24+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF047C07+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
JMFF048G06+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTCTG
JMSF031F04+ GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
                      ____________________________________________________________
consensus GCCCAGATGAAGGTTTAGGAGCAAAGGCCCCACCCAACTTGTCCAGCATCCAATGTTTTG
 
. : . : . : . : . : . :
JMFF006D03+ GGGCATTTAGCCTCTTCAAATGCTTCTTCAACCCTCTAGCCATGTTGG
JMFF020L19+ GGGCATTTAGCCTCTTCAAATGCTTCTTCAACCCTCTAGCCATGTTGG
JMSF041N17+ GGGCATTTAGCCTCTTCAAATGCTTCTTCAACCCTCTAGCCATGTTGG
JMFN039C07+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGC
JMSF042G19+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF042P10+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF044G19+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF026E15+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF016H06+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF018E18+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF047I08+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF039L13+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF014G02+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF001A20+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF008P05+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF018N08+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF024I14+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF035H20+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF026E04+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF025J24+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF047C07+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMFF048G06+ GGTCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
JMSF031F04+ GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
                      ____________________________________________________________
consensus GGGCATTTAGCCTCTTCATATGCTTCTTCAACCCTCGAGCCATGGTGGTGGAAAGCTGAG
 
. : . : . : . : . : . :
JMSF042G19+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAAC
JMFF042P10+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAA
JMSF044G19+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACC
JMFF026E15+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATT
JMFF016H06+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTC
JMSF018E18+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGC
JMFF047I08+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTC
JMFF039L13+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTC
JMSF014G02+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTC
JMFF001A20+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACC
JMFF008P05+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCC
JMSF018N08+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCC
JMFF024I14+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCC
JMSF035H20+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCC
JMFF026E04+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATT
JMFF025J24+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAAT
JMFF047C07+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGAGCCGGTTCAAACC
JMFF048G06+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCC
JMSF031F04+ TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCCCAA
                      ____________________________________________________________
consensus TGTTCGGCCGTCGCCGGTGGTGCCTACTCCGCTGCTCCTAAGTGCCAATTCAAACCCCAA