Previous Contig 006717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028F01Sequence472006717 (3)sp|Q9C509|SGPL_ARATH6e-18Sphingosine-1-phosphate lyase (EC 4.1.2.27) (SP-lyase) (SPL) (Sphingosine-1-phos588009544 (3)gb:AP003727_18325261e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF007H16Sequence333006717 (3)sp|Q9C509|SGPL_ARATH6e-06Sphingosine-1-phosphate lyase (EC 4.1.2.27) (SP-lyase) (SPL) (Sphingosine-1-phos752009544 (3)sp|Q9C509|SGPL_ARATHe-101Sphingosine-1-phosphate lyase (EC 4.1.2.27) (SP-lyase) (SPL) (Sphingosine-1-phos
JMSF031C10Sequence683006717 (3)sp|Q9C509|SGPL_ARATH1e-45Sphingosine-1-phosphate lyase (EC 4.1.2.27) (SP-lyase) (SPL) (Sphingosine-1-phos777009544 (3)sp|Q9C509|SGPL_ARATHe-110Sphingosine-1-phosphate lyase (EC 4.1.2.27) (SP-lyase) (SPL) (Sphingosine-1-phos

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031C10+ TCAGCTTCAAATCTTACGACGCT
                      ____________________________________________________________
consensus TCAGCTTCAAATCTTACGACGCT
 
. : . : . : . : . : . :
JMSF031C10+ NGGAAATACATCCATATGTAGCGGGTTGGTATGGGCAAACATTGAGCATGCTTGGTTTAT
                      ____________________________________________________________
consensus NGGAAATACATCCATATGTAGCGGGTTGGTATGGGCAAACATTGAGCATGCTTGGTTTAT
 
. : . : . : . : . : . :
JMSF031C10+ CAAAGAAAAATGCCCTTCATTCTCATTCCCTCCAATATAGATTGTACCAGAACATTTGCC
                      ____________________________________________________________
consensus CAAAGAAAAATGCCCTTCATTCTCATTCCCTCCAATATAGATTGTACCAGAACATTTGCC
 
. : . : . : . : . : . :
JMFF028F01+ GTCACATCGTTCTCTTTCTCGTCTCTCATTTTCTCTATGACACCGTCTCCCAA
JMSF031C10+ CTGCCAGGTCACATCGTTCTCTTTCTCGTCTCTCATTTTCTCTATGACACCGTCTCCCAA
                      ____________________________________________________________
consensus CTGCCAGGTCACATCGTTCTCTTTCTCGTCTCTCATTTTCTCTATGACACCGTCTCCCAA
 
. : . : . : . : . : . :
JMFF028F01+ ACCTGTCTTCGGCAAATCAGTTCTCCATCCATCTCTCTTAGATTTCCCCGAAGCTTGCAT
JMSF031C10+ ACCTGTCTTCGGCAAATCAGTTCTCCATCCATCTCTCTTAGATTTCCCCGAAGCTTGCAT
                      ____________________________________________________________
consensus ACCTGTCTTCGGCAAATCAGTTCTCCATCCATCTCTCTTAGATTTCCCCGAAGCTTGCAT
 
. : . : . : . : . : . :
JMSF007H16+ CAGAATCGATATAACTTTTCACGCCAGGAACCAACTT
JMFF028F01+ CTTTTCTACAACCTTTTGTTTCTCAGAATCGATATAACTTTTCACGCCAGGAACCAACTT
JMSF031C10+ CTTTTCTACAACCTTTTGTTTCTCAGAATCGATATAACTTTTCACGCCAGGAACCAACTT
                      ____________________________________________________________
consensus CTTTTCTACAACCTTTTGTTTCTCAGAATCGATATAACTTTTCACGCCAGGAACCAACTT
 
. : . : . : . : . : . :
JMSF007H16+ GACTAAGCTCATGAAGAACCCAAGAAGCGTAGCTTTGAGGCCATGTTCATGGATAACAGC
JMFF028F01+ GACTAAGCTCATGAAGAACCCAAGAAGCGTAGCTTTGAGGCCATGTTCATGGATAACAGC
JMSF031C10+ GACTAAGCTCATGAAGAACCCAAGAAGCGTAGCTTTGAGGCCATGTTCATGGATAACAGC
                      ____________________________________________________________
consensus GACTAAGCTCATGAAGAACCCAAGAAGCGTAGCTTTGAGGCCATGTTCATGGATAACAGC
 
. : . : . : . : . : . :
JMSF007H16+ GAAGAAAGATTGAAGAAGCCGAGCAACGAGCAGAGAGAGCAGCGGGGCGAGAAGCAGAGC
JMFF028F01+ GAAGAAAGATTGAAGAAGCCGAGCAACGAGCAGAGAGAGCAGCGGGGCGAGAAGCAGAGC
JMSF031C10+ GAAGAAAGATTGAAGAAGCCGAGCAACGAGCAGAGAGAGCAGCGGGGCGAGAAGCAGAGC
                      ____________________________________________________________
consensus GAAGAAAGATTGAAGAAGCCGAGCAACGAGCAGAGAGAGCAGCGGGGCGAGAAGCAGAGC
 
. : . : . : . : . : . :
JMSF007H16+ AAGAGGCTCGTAGTGGGCCAAGAAGGAGTTGGCGGAAGCTCTGAGTCGGGTGAGCGAAGC
JMFF028F01+ AAGAGGCTCGTAGTGGGCCAAGAAGGAGTTGGCGGAAGCTCTGAGTCGGGTGAGCGAAGC
JMSF031C10+ AAGAGGCTCGTAGTGGGCCAAGAAGGAGTTGGCGGAAGCTCTGAGTCGGGTGAGCGAAGC
                      ____________________________________________________________
consensus AAGAGGCTCGTAGTGGGCCAAGAAGGAGTTGGCGGAAGCTCTGAGTCGGGTGAGCGAAGC
 
. : . : . : . : . : . :
JMSF007H16+ AAACTCCATTGCCAGATCGATGCGAACAAGAAAGCAGATAGTTCTTCAAAGTTCAAACCC
JMFF028F01+ AAACTCCATTGCCAGATCGATGCGAACAAGAAAGCAGATAGTTCTTCAAAGTTCAAACCC
JMSF031C10+ AAACTCCATTGCCAGATCGATGCGAACAAGAAAGCAGATAGTTCTTCAAAGTTCAAACCC
                      ____________________________________________________________
consensus AAACTCCATTGCCAGATCGATGCGAACAAGAAAGCAGATAGTTCTTCAAAGTTCAAACCC
 
. : . : . : . : . : . :
JMSF007H16+ GATACAAGAAGAAGATAAGGAGAATTGTATATTACTATTTGTTGGTCTTTGTCT
JMFF028F01+ GATACAAGAAGAAGATAAGGAGAATTGTATATTACTATTTGTTGGTCTTTGTCT
JMSF031C10+ GATACAAGAAGAAGATAAGGAGAATTGTATATTACTATTTGTTGGTCTTTGTCTTATTCA
                      ____________________________________________________________
consensus GATACAAGAAGAAGATAAGGAGAATTGTATATTACTATTTGTTGGTCTTTGTCTTATTCA
 
. : . : . : . : . : . :
JMSF031C10+ TCTTCTTCTCCCATCGCACTGCATTTTAAGCAATCCTATGGGCGCAAGAATAGCGCGGTC
                      ____________________________________________________________
consensus TCTTCTTCTCCCATCGCACTGCATTTTAAGCAATCCTATGGGCGCAAGAATAGCGCGGTC