Previous Contig 006716:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031J06Sequence568006716 (7)gb:ATAC010870_15431821e-34Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen793006716 (7)gb:ATAC010870_15431822e-51Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen
JMFF038O03Sequence570006716 (7)gb:ATAC010870_15431829e-32Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen720006716 (7)gb:AE016959_10229261e-40Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC03
JMSF029P14Sequence675006716 (7)gb:ATAC010870_15431822e-53Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen
JMSF031C09Sequence640006716 (7)gb:ATAC010870_15431822e-37Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen689006716 (7)gb:AE016959_10229269e-41Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC03

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038O03- GATTTTGCATAAATAGACA
                      ____________________________________________________________
consensus GATTTTGCATAAATAGACA
 
. : . : . : . : . : . :
rJMFF038O03- AGCATCCTAATACACACACCATCGTATATCTACATTTCATGTATTGGATGTCACGTCCAA
                      ____________________________________________________________
consensus AGCATCCTAATACACACACCATCGTATATCTACATTTCATGTATTGGATGTCACGTCCAA
 
. : . : . : . : . : . :
rJMFF038O03- CATTGCTAGACTTCTCAAGTCAAATCCGTAAATCGTGACATCGTTTGAGGGTTATGCTTT
                      ____________________________________________________________
consensus CATTGCTAGACTTCTCAAGTCAAATCCGTAAATCGTGACATCGTTTGAGGGTTATGCTTT
 
. : . : . : . : . : . :
rJMFF038O03- CAGCTACTTCATGCCACAGTCCACTTGAAACTCCCCATTTTTTAGATACACAGCTAAATT
rJMSF031C09- AGATACACAGCTAAATT
rJMFF031J06- AGATACACAGCTAAATT
                      ____________________________________________________________
consensus CAGCTACTTCATGCCACAGTCCACTTGAAACTCCCCATTTTTTAGATACACAGCTAAATT
 
. : . : . : . : . : . :
rJMFF038O03- TGCCTGGGCATCAGCTTCGGAGTTGTATTCTCTTTCAACATGGTTAATCTGGAAAGATGT
rJMSF031C09- TGCCTGGGCATCAGCTTCGGAGTTGTATTCTCTTTCAACATGGTTAATCTGGAAAGATGT
rJMFF031J06- TGCCTGGGCATCAGCTTCGGAGTTGTATTCTCTTTCAACATGGTTAATCTGGAAAGATGT
                      ____________________________________________________________
consensus TGCCTGGGCATCAGCTTCGGAGTTGTATTCTCTTTCAACATGGTTAATCTGGAAAGATGT
 
. : . : . : . : . : . :
rJMFF038O03- GAATTGGTCCTTGTATTCTCTGACCACCTTTGACAGCTCGGCCATGTTCTGGTTCTTGGT
rJMSF031C09- GAATTGGTCCTTGTATTCTCTGACCACCTTTGACAGCTCGGCCATGTTCTGGTTCTTGGT
rJMFF031J06- GAATTGGTCCTTGTATTCTCTGACCACCTTTGACAGCTCGGCCATGTTCTGGTTCTTGGT
                      ____________________________________________________________
consensus GAATTGGTCCTTGTATTCTCTGACCACCTTTGACAGCTCGGCCATGTTCTGGTTCTTGGT
 
. : . : . : . : . : . :
rJMFF038O03- TCTCCAGATTCCTTGAGTCTGCATGCAGACAAGCTTTGAATCTCCTTGGGCTCGTATGTG
rJMSF031C09- TCTCCAGATTCCTTGAGTCTGCATGCAGACAAGCTTTGAATCTCCTTGGGCTCGTATGTG
rJMFF031J06- TCTCCAGATTCCTTGAGTCTGCATGCAGACAAGCTTTGAATCTCCTTGGGCTCGTATGTG
rJMSF029P14+ GCATGCAGACAAGCTTTGAATCTCCTTGGGCTCGTATGTG
                      ____________________________________________________________
consensus TCTCCAGATTCCTTGAGTCTGCATGCAGACAAGCTTTGAATCTCCTTGGGCTCGTATGTG
 
. : . : . : . : . : . :
rJMFF038O03- TTTAAACCCTTTCTCAAGAGCATACTTCAATCCCAAGATCAAACCCCTGTATTCAGCAAC
rJMSF031C09- TTTAAACCCTTTCTCAAGAGCATACTTCAATCCCAAGATCAAACCCCTGTATTCAGCAAC
rJMFF031J06- TTTAAACCCTTTCTCAAGAGCATACTTCAATCCCAAGATCAAACCCCTGTATTCAGCAAC
rJMSF029P14+ TTTAAACCCTTTCTCAAGAGCATACTTCAATCCCAAGATCAAACCCCTGTATTCAGCAAC
                      ____________________________________________________________
consensus TTTAAACCCTTTCTCAAGAGCATACTTCAATCCCAAGATCAAACCCCTGTATTCAGCAAC
 
. : . : . : . : . : . :
rJMFF038O03- GTTGTTGGTTGCAACACCCACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
rJMSF031C09- GTTGTTGGTTGCAACACCCACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
rJMFF031J06- GTTGTTGGTTGCAACACCCACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
rJMSF029P14+ GTTGTTGGTTGCAACACCCACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
JMFF031J06+ TCTGCAGC
JMFF038O03+ ATCTGCAGC
JMSF031C09+ CACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
                      ____________________________________________________________
consensus GTTGTTGGTTGCAACACCCACGCCTTCACGCAACCGGAAAACCATACTTCCATCTGCAGC
 
. : . : . : . : . : . :
rJMFF038O03- ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
rJMSF031C09- ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
rJMFF031J06- ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
rJMSF029P14+ ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
JMFF031J06+ ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
JMFF038O03+ ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
JMSF031C09+ ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
                      ____________________________________________________________
consensus ACGCAGCACAGCCCCAGCACCAGCAAGTCCAGGATTTCCCTTTGAAGCACCATCGAACTC
 
. : . : . : . : . : . :
rJMFF038O03- AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
rJMSF031C09- AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
rJMFF031J06- AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
rJMSF029P14+ AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
JMFF031J06+ AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
JMFF038O03+ AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGGAAAATTATCTAATT
JMSF031C09+ AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
                      ____________________________________________________________
consensus AAGAATACAGGAACTACAGTAAGAAGAAATTGGAGGGACTTCAAGG-AAATTATCTAATT
 
. : . : . : . : . : . :
rJMFF038O03- TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
rJMSF031C09- TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
rJMFF031J06- TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
rJMSF029P14+ TTCCTGGTTTTTGNTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
JMFF031J06+ TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
JMFF038O03+ TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
JMSF031C09+ TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
                      ____________________________________________________________
consensus TTCCTGGTTTTTGCTGAGTAGCTGTTGAATACAAAGGAGATCCAGCCATTTCCTGTGCCC
 
. : . : . : . : . : . :
rJMFF038O03- GTTTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAA
rJMSF031C09- G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAAC
rJMFF031J06- G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
rJMSF029P14+ G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
JMFF031J06+ G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
JMFF038O03+ G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
JMSF031C09+ G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
                      ____________________________________________________________
consensus G-TTTCTCCTGAAAGTCCTTGCTGAGTGGTTTATCTTTGGAAGAACCAGGTTGCCGGAAA
 
. : . : . : . : . : . :
rJMFF031J06- GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
rJMSF029P14+ GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
JMFF031J06+ GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
JMFF038O03+ GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
JMSF031C09+ GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
                      ____________________________________________________________
consensus GGACAGGGTACAAGTAAGCCAAAGAGATCATCTCGAACATCAGTGCTGTCAACGGAGTAC
 
. : . : . : . : . : . :
rJMFF031J06- ATTGCATTCTTAAG
rJMSF029P14+ ATTGCATTCTTAAGCCCATGAGAAGTAAGATATTCTTCAGATTCTTTAGCCAAGTGATAC
JMFF031J06+ ATTGCATTCTTAAGCCCATGAGAAGTAAGATATTCTTCAGATTCTTTAGCCAAGTGATAC
JMFF038O03+ ATTGCATTCTTAAGCCCATGAGAAGTAAGATATTCTTCAGATTCTTTAGCCAAGTGATAC
JMSF031C09+ ATTGCATTCTTAAGCCCATGAGAAGTAAGATATTCTTCAGATTCTTTAGCCAAGTGATAC
                      ____________________________________________________________
consensus ATTGCATTCTTAAGCCCATGAGAAGTAAGATATTCTTCAGATTCTTTAGCCAAGTGATAC
 
. : . : . : . : . : . :
rJMSF029P14+ CCTTTATATACACTTATAGAAGGTTCACCAACAGAAGAGCGAATTAGGGCTTGGAGATCA
JMFF031J06+ CCTTTATATACACTTATAGAAGGTTCACCAACAGAAGAGCGAATTAGGGCTTGGAGATCA
JMFF038O03+ CCTTTATATACACTTATAGAAGGTTCACCAACAGAAGAGCGAATTAGGGCTTGGAGATCA
JMSF031C09+ CCTTTATATACACTTATAGAAGGTTCACCAACAGAAGAGCGAATTAGGGCTTGGAGATCA
                      ____________________________________________________________
consensus CCTTTATATACACTTATAGAAGGTTCACCAACAGAAGAGCGAATTAGGGCTTGGAGATCA
 
. : . : . : . : . : . :
rJMSF029P14+ CTTAAGCTTTTGTAGATACCAATAACGTTGCCCTTACGGACGACATAAAATGCATCCTTT
JMFF031J06+ CTTAAGCTTTTGTAGATACCAATAACGTTGCCCTTACGGACGACATAAAATGCATCCTTT
JMFF038O03+ CTTAAGCTTTTGTAGATACCAATAACGTTGCCCTTACGGACGACATAAAATGCATCCTTT
JMSF031C09+ CTTAAGCTTTTGTAGATACCAATAACGTTGCCCTTACGGACGACATAAAATGCATCCTTT
                      ____________________________________________________________
consensus CTTAAGCTTTTGTAGATACCAATAACGTTGCCCTTACGGACGACATAAAATGCATCCTTT
 
. : . : . : . : . : . :
rJMSF029P14+ TCGTCTCCCATTGATTGATGCTTCAGCCACAATGACA
JMFF031J06+ TCGTCTCCCATTGATTGATGCTTCAGCCACAATGACAT--------CTTCTAAGCTCTGA
JMFF038O03+ TCGTCTCCCATTGAT
JMSF031C09+ TCGTCTCCCATTGATTGATGCTTCAGCCACAATGACATCTACCCAGCTTCTAAGCTCTGA
                      ____________________________________________________________
consensus TCGTCTCCCATTGATTGATGCTTCAGCCACAATGACATCTACCCAGCTTCTAAGCTCTGA
 
. : . : . : . : . : . :
JMFF031J06+ GCTCTCCACTCCCGACTCCCGAGTTTTGAC
JMSF031C09+ GCTCTCCACTCCCGACTCCCGAGTTTTGACAGCGATGTGTTGCGACATCCGACGACTAGC
                      ____________________________________________________________
consensus GCTCTCCACTCCCGACTCCCGAGTTTTGACAGCGATGTGTTGCGACATCCGACGACTAGC