Previous Contig 006707:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031A10Sequence676006707 (2)715013507 (3)pir|T45710|T457107e-18H-protein promoter binding factor-2a [imported] - Arabidopsis thaliana>gb:ATF1P2
JMSF043M24Sequence757006707 (2)623013507 (3)pir|T09661|T096612e-10ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043M24+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMSF043M24+ TCCTTATGGTCCTTTACCGACTAGGGTCACAAAACAGGATTTACGCGCTTTGGGTAGTGG
                      ____________________________________________________________
consensus TCCTTATGGTCCTTTACCGACTAGGGTCACAAAACAGGATTTACGCGCTTTGGGTAGTGG
 
. : . : . : . : . : . :
JMSF043M24+ CGGCAGGTTTCTCTTGTCACCCCAATAAAAGAGACAAGACATTAAGGCTAAGATTTTGCA
                      ____________________________________________________________
consensus CGGCAGGTTTCTCTTGTCACCCCAATAAAAGAGACAAGACATTAAGGCTAAGATTTTGCA
 
. : . : . : . : . : . :
JMSF043M24+ TACCAAACATGGGGGCATGTATAATCAATTCAATTCAATCAAAGTTGCAAACTTTGGACT
                      ____________________________________________________________
consensus TACCAAACATGGGGGCATGTATAATCAATTCAATTCAATCAAAGTTGCAAACTTTGGACT
 
. : . : . : . : . : . :
JMSF043M24+ CAATTCCAGAAATTTCTTGGATTCAATTCAAGAAACAACCATAGGGTTGTAGCTGTGATT
                      ____________________________________________________________
consensus CAATTCCAGAAATTTCTTGGATTCAATTCAAGAAACAACCATAGGGTTGTAGCTGTGATT
 
. : . : . : . : . : . :
JMSF043M24+ CTTCATTTCATTTCTAGGAGATCCAAAATGGTTCAGAACAATTCAATCAAAGTTGCAAAC
JMSF031A10+ AATCAAAGGTGCAAAC
                      ____________________________________________________________
consensus CTTCATTTCATTTCTAGGAGATCCAAAATGGTTCAGAACAATTCAATCAAAGTTGCAAAC
 
. : . : . : . : . : . :
JMSF043M24+ TTTGGACTCAATTTCCAGAAATATGATCAACCCATTACTCACTATACTACTCTGGATAAT
JMSF031A10+ TTNGGACTCAATTTCCAGAAATATGATCAACCCATTACTCACTATACTACTCTGGATAAT
                      ____________________________________________________________
consensus TTTGGACTCAATTTCCAGAAATATGATCAACCCATTACTCACTATACTACTCTGGATAAT
 
. : . : . : . : . : . :
JMSF043M24+ GGGTTTCCCTTAAACACCACAAAAAGCCTTCATTCAAGCCAATATATTTTCTTTTGAATG
JMSF031A10+ GGGTTTCCCTTAAACACCACAAAAAGCCTTCATTCAAGCCAATATATTTTCTTTTGAATG
                      ____________________________________________________________
consensus GGGTTTCCCTTAAACACCACAAAAAGCCTTCATTCAAGCCAATATATTTTCTTTTGAATG
 
. : . : . : . : . : . :
JMSF043M24+ CAGAAGAAATAGAAACAGAGCTTTATATATCATATCATATATATATACTAAAAACAACCC
JMSF031A10+ CAGAAGAAATAGAAACAGAGCTTTATATATCATATCATATATATATACTAAAAACAACCC
                      ____________________________________________________________
consensus CAGAAGAAATAGAAACAGAGCTTTATATATCATATCATATATATATACTAAAAACAACCC
 
. : . : . : . : . : . :
JMSF043M24+ AATATTTTCATATTCCATTACGTAAAACTAGCAAAACAGAAGTAGTGCCAAATATAAGCA
JMSF031A10+ AATATTTTCATATTCCATTACGTAAAACTAGCAAAACAGAAGTAGTGCCAAATATAAGCA
                      ____________________________________________________________
consensus AATATTTTCATATTCCATTACGTAAAACTAGCAAAACAGAAGTAGTGCCAAATATAAGCA
 
. : . : . : . : . : . :
JMSF043M24+ TGGTTTTTCAAGAATTCTACCATGTTGTCTTGGGAAGGTGTCGAGACAGAAATGGAAACG
JMSF031A10+ TGGTTTTTCAAGAATTCTACCATGTTGTCTTGGGAAGGTGTCGAGACAGAAATGGAAACG
                      ____________________________________________________________
consensus TGGTTTTTCAAGAATTCTACCATGTTGTCTTGGGAAGGTGTCGAGACAGAAATGGAAACG
 
. : . : . : . : . : . :
JMSF043M24+ TCGGCGTCGCCGTCTTGCGGCGGCGGCGGCGGCGGTGGCAGAGAGATCGTCATCCCGAAG
JMSF031A10+ TCGGCGTCGCCGTCTTGCGGCGGCGGCGGCGGCGGTGGCAGAGAGATCGTCATCCCGAAG
                      ____________________________________________________________
consensus TCGGCGTCGCCGTCTTGCGGCGGCGGCGGCGGCGGTGGCAGAGAGATCGTCATCCCGAAG
 
. : . : . : . : . : . :
JMSF043M24+ AGCTTGATCGCCGGGTCTTTCACTTCCGACATTCTGGTTTGCTTTTGATTCTCTCCCATG
JMSF031A10+ AGCTTGATCGCCGGGTCTTTCACTTCCGACATTCTGGTTTGCTTTTGATTCTCTCCCATG
                      ____________________________________________________________
consensus AGCTTGATCGCCGGGTCTTTCACTTCCGACATTCTGGTTTGCTTTTGATTCTCTCCCATG
 
. : . : . : . : . : . :
JMSF043M24+ TTTTCGACTTTTCGTTTTCTCCCTTTTCCAACGC
JMSF031A10+ TTTTCGACTTTTCGTTTTCTCCCTTTTCCAACGCACGAAACACAACAACACCCAAAAGTC
                      ____________________________________________________________
consensus TTTTCGACTTTTCGTTTTCTCCCTTTTCCAACGCACGAAACACAACAACACCCAAAAGTC
 
. : . : . : . : . : . :
JMSF031A10+ TCTCTTTGTAGCAGCTTTTTTTTTCTCGGTTTCTACGCTCTCTCTCTCTTTCTCTTTCTC
                      ____________________________________________________________
consensus TCTCTTTGTAGCAGCTTTTTTTTTCTCGGTTTCTACGCTCTCTCTCTCTTTCTCTTTCTC
 
. : . : . : . : . : . :
JMSF031A10+ TCTCTCCACTTTTTTCAAACGGAGTTTCAGTTCAACTCTGCGGCGGCATATATGATTCGT
                      ____________________________________________________________
consensus TCTCTCCACTTTTTTCAAACGGAGTTTCAGTTCAACTCTGCGGCGGCATATATGATTCGT
 
. : . : . : . : . : . :
JMSF031A10+ CGTCGTTTTGAGTTCGGCTCATTTTTCTTTTGTTGATTTTTGCGATCAAGTACGAAGATC
                      ____________________________________________________________
consensus CGTCGTTTTGAGTTCGGCTCATTTTTCTTTTGTTGATTTTTGCGATCAAGTACGAAGATC