Previous Contig 006704:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001D02Sequence589006704 (19)gb:AP003241_18260693e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040560006704 (19)gb:AP003241_18260692e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF009L15Sequence589006704 (19)gb:AP003241_18260691e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040565006704 (19)gb:AP003241_18260691e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF014K08Sequence543006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF022L03Sequence521006704 (19)gb:AP003241_18260692e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040529006704 (19)gb:AP003241_18260692e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF022L15Sequence516006704 (19)gb:AP003241_18260692e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040561006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF024L15Sequence443006704 (19)gb:AP003241_18260694e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040565006704 (19)gb:AP003241_18260696e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF047A15Sequence575006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040337006704 (19)
JMFN005N18Sequence539006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFS048F08Sequence491006704 (19)gb:AP003241_18260692e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF030P14Sequence597006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040546006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF038L05Sequence590006704 (19)gb:AP003241_18260693e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040531006704 (19)gb:AP003241_18260692e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047A15- ATTTTTTTTTTTTTCAAAGGACCAAATTAGTAATTTAACTCTAATA
                      ____________________________________________________________
consensus ATTTTTTTTTTTTTCAAAGGACCAAATTAGTAATTTAACTCTAATA
 
. : . : . : . : . : . :
rJMFF047A15- AATACTAAACTGGGTTTATGGCATAGTATGCCAAAAGGCTGCAATGAACACATACATGTG
JMFF001D02+ TG
JMFF009L15+ TG
JMSF038L05+ G
                      ____________________________________________________________
consensus AATACTAAACTGGGTTTATGGCATAGTATGCCAAAAGGCTGCAATGAACACATACATGTG
 
. : . : . : . : . : . :
rJMFF047A15- GATATGCAAATGATAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
JMFF001D02+ GATATGCAAATGATAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMFF009L15- TAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
JMFF009L15+ GATATGCAAATGATAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMFF022L03- ATTCTTTGGGT
JMFS048F08+ AGGGAAAATTCTTTGGGT
JMFF047A15+ TATGCAAATGAT-AGTTTTAATTTGTGGATGAAATNNTAAAGGGAAAATTCTTTGGGT
JMFF022L03+ GT
JMSF038L05+ GATATGCAAATGATAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMFF024L15- TAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
JMFN005N18+ AATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMFF022L15- TAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMSF030P14- CTTTGGGT
rJMFF001D02- TGAAAATTTTAAGGGAAAATTCTTTGGGT
rJMFF014K08- ATTTGTGGATG-AAATTTTAAGGGAAAATTCTTTGGGT
rJMSF038L05- AATTCTTTGGGT
JMFF022L15+ GT
JMSF030P14+ TAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
                      ____________________________________________________________
consensus GATATGCAAATGATAAGTTTTAATTTGTGGATGAAAATTTTAAGGGAAAATTCTTTGGGT
 
. : . : . : . : . : . :
rJMFF047A15- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFF001D02+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF009L15- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFF009L15+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF022L03- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFS048F08+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFF047A15+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFF022L03+ ATATCAGTCTCAGAAAGTGANCAAAAATACATATGAAAGGGTAAATCTGCTCATGTTTTA
JMSF038L05+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF024L15- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFN005N18+ ATATCAGTCTCAGAAAGTAAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF022L15- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMSF030P14- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF001D02- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMFF014K08- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
rJMSF038L05- ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMFF022L15+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
JMSF030P14+ ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
                      ____________________________________________________________
consensus ATATCAGTCTCAGAAAGTGAACAAAAATACATATGAAA-GGTAAATCTGCTCATGTTTTA
 
. : . : . : . : . : . :
rJMFF047A15- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF001D02+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTTCCCTTGCCATAGATATATAGT
rJMFF009L15- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF009L15+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMFF022L03- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFS048F08+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF047A15+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF022L03+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMSF038L05+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMFF024L15- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFN005N18+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMFF022L15- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMSF030P14- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMFF001D02- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMFF014K08- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
rJMSF038L05- ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF022L15+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMFF024L15+ ACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
JMSF030P14+ ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
                      ____________________________________________________________
consensus ACTAATTGAACCTTCAACATAAAACAAAACAGCTATCTT-CCTTGCCATAGATATATAGT
 
. : . : . : . : . : . :
rJMFF047A15- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGG
JMFF001D02+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF009L15- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFF009L15+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF022L03- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFS048F08+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFF047A15+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFF022L03+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMSF038L05+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF024L15- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFN005N18+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF022L15- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMSF030P14- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF001D02- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMFF014K08- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
rJMSF038L05- GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFF022L15+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMFF024L15+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
JMSF030P14+ GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
                      ____________________________________________________________
consensus GCAAGAAGGTTTATTTCTTCTTGTCACCACCTCCAGTAGCCCTCATCTTTCGGAGAACAC
 
. : . : . : . : . : . :
JMFF001D02+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF009L15- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTATTGTGAGTACCCAACTTTCGCTTGGCTA
JMFF009L15+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTATTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF022L03- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFS048F08+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFF047A15+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFF022L03+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMSF038L05+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF024L15- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFN005N18+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF022L15- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMSF030P14- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF001D02- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMFF014K08- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
rJMSF038L05- CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFF022L15+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMFF024L15+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
JMSF030P14+ CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
                      ____________________________________________________________
consensus CAGACATCTCCTCTCTCTTCCTTTTAGCCCTCTTGTGAGTACCCAACTTTCGCTTGGCTA
 
. : . : . : . : . : . :
JMFF001D02+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF009L15- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFF009L15+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF022L03- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFS048F08+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFF047A15+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFF022L03+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMSF038L05+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF024L15- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGATCAGTGATCCTCTTCTCGTACG
JMFN005N18+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF022L15- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMSF030P14- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF001D02- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMFF014K08- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
rJMSF038L05- CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFF022L15+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
JMFF024L15+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGATCAGTGATCCTCTTCTCGTACG
JMSF030P14+ CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
                      ____________________________________________________________
consensus CCTTCAAAGCACGCTTGTCCTTTCCAACTTTAAGAAGCTCAGTGATCCTCTTCTCGTACG
 
. : . : . : . : . : . :
JMFF001D02+ TAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF009L15- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFF009L15+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF022L03- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFS048F08+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFF047A15+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFF022L03+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMSF038L05+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF024L15- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFN005N18+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF022L15- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMSF030P14- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF001D02- TAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMFF014K08- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
rJMSF038L05- GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFF022L15+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMFF024L15+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
JMSF030P14+ GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
                      ____________________________________________________________
consensus GAGCAAATCCAGCAACTTCCCTGATCAGGCTCTTCACGAAATTGATTCTTTTGCTTGTTT
 
. : . : . : . : . : . :
JMFF001D02+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF009L15- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFF009L15+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF022L03- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFS048F08+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFF047A15+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFF022L03+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMSF038L05+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF024L15- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFN005N18+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF022L15- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMSF030P14- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF001D02- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMFF014K08- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
rJMSF038L05- TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFF022L15+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMFF024L15+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
JMSF030P14+ TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
                      ____________________________________________________________
consensus TGCCTTTCCGATCAGAGGGCCGTGGTGCTAGTTCCTTCTTGGTCACAACATGTCCTCTGT
 
. : . : . : . : . : . :
JMFF001D02+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF009L15- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFF009L15+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF022L03- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFS048F08+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGAT
JMFF047A15+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFF022L03+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMSF038L05+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF024L15- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFN005N18+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF022L15- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMSF030P14- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF001D02- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMFF014K08- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
rJMSF038L05- TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFF022L15+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMFF024L15+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
JMSF030P14+ TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
                      ____________________________________________________________
consensus TCAGTCCAACAAACAGCCCAGAATTAGCCTGTTTCGGCGCCATCCCTCGTTCGATTTGAT
 
. : . : . : . : . : . :
JMFF001D02+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACC
rJMFF009L15- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMFF009L15+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
rJMFF022L03- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMFF047A15+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMFF022L03+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMSF038L05+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
rJMFF024L15- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMFN005N18+ TCTGCGATGGCCGGAGGCGGGC
rJMFF022L15- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAAC
rJMSF030P14- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCTAGGGTTTTGGTAGACTCCAC
rJMFF001D02- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACC
rJMFF014K08- TCTGCGATGGCCGGAGGCGGGCGATGAT
rJMSF038L05- TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMFF022L15+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAAC
JMFF024L15+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCT
JMSF030P14+ TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCTAGGGTTTTGGTAGACTCCAC
                      ____________________________________________________________
consensus TCTGCGATGGCCGGAGGCGGGCGATGATGGAAGAACACCTAGGGTTTTGGTAGACTCCAC