Previous Contig 006703:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018H18Sequence480006703 (3)gb:AY039953_15604637e-35Arabidopsis thaliana unknown protein (At1g30890) mRNA, complete cds.>gb:AY086444769006703 (3)pir|T49291|T492917e-89hypothetical protein T16L24.50 - Arabidopsis thaliana>gb:ATT16L24_1554640 Arabid
JMSF030P08Sequence645006703 (3)gb:AY039953_15604631e-59Arabidopsis thaliana unknown protein (At1g30890) mRNA, complete cds.>gb:AY086444

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018H18- GTCTGATCTTGGTCATTTCC
                      ____________________________________________________________
consensus GTCTGATCTTGGTCATTTCC
 
. : . : . : . : . : . :
rJMSF018H18- TTTTCTCCCTCAATTTGTACACCACGTTTATGGTACATTTTTGTTGGACAAAAGATACAT
                      ____________________________________________________________
consensus TTTTCTCCCTCAATTTGTACACCACGTTTATGGTACATTTTTGTTGGACAAAAGATACAT
 
. : . : . : . : . : . :
rJMSF018H18- TAGATGAGAACTCTGTCAAATATTCAGAAAAGTACCACAAAGATATTACAGAAAAATAAA
                      ____________________________________________________________
consensus TAGATGAGAACTCTGTCAAATATTCAGAAAAGTACCACAAAGATATTACAGAAAAATAAA
 
. : . : . : . : . : . :
rJMSF018H18- AAAATTGTTCAACAAAATTGACAGTAAGTTCTATAGCTATGGAGGTAAGGGGGCGGTACT
                      ____________________________________________________________
consensus AAAATTGTTCAACAAAATTGACAGTAAGTTCTATAGCTATGGAGGTAAGGGGGCGGTACT
 
. : . : . : . : . : . :
rJMSF018H18- TCAAAAGAACCAACTAATGCTAATCTTTCCAAGCCAGAAGAGAAGGGGGAACTGAGAGAG
                      ____________________________________________________________
consensus TCAAAAGAACCAACTAATGCTAATCTTTCCAAGCCAGAAGAGAAGGGGGAACTGAGAGAG
 
. : . : . : . : . : . :
rJMSF018H18- GGCGACAAAGAGGAGGATATAATGATGCCTGCTTGAATCGTAAGTCCTCACCTCTGCAAA
                      ____________________________________________________________
consensus GGCGACAAAGAGGAGGATATAATGATGCCTGCTTGAATCGTAAGTCCTCACCTCTGCAAA
 
. : . : . : . : . : . :
rJMSF018H18- GAGTGCCCTCTTCATTGTTTTCACAAGGAATATCCCCATGCATAGACCAGCCCATGGCAT
                      ____________________________________________________________
consensus GAGTGCCCTCTTCATTGTTTTCACAAGGAATATCCCCATGCATAGACCAGCCCATGGCAT
 
. : . : . : . : . : . :
rJMSF018H18- CAAAAAGTAGTAGGAATAGTTCCATAAAATCTTCCCCAAGATAGCCACCGACAAACCCGC
                      ____________________________________________________________
consensus CAAAAAGTAGTAGGAATAGTTCCATAAAATCTTCCCCAAGATAGCCACCGACAAACCCGC
 
. : . : . : . : . : . :
rJMSF018H18- AAAAGTGTATCCTGCATATGCCACAATGTCCAGCAAAGGTGCTTCTCCACTACCAAGTGA
                      ____________________________________________________________
consensus AAAAGTGTATCCTGCATATGCCACAATGTCCAGCAAAGGTGCTTCTCCACTACCAAGTGA
 
. : . : . : . : . : . :
rJMSF018H18- GAAAAGTGTCATCTTCAGCAATGAAACTTGTAAAAACCAGCCAACCAAACCCTTCATGAA
                      ____________________________________________________________
consensus GAAAAGTGTCATCTTCAGCAATGAAACTTGTAAAAACCAGCCAACCAAACCCTTCATGAA
 
. : . : . : . : . : . :
rJMSF018H18- CAGCCAGTTTAGGGCTTCAGGGCTAAACCTTCCCTGGAGA-CCCAATGATAAACCAGCGA
JMSF030P08+ TTCAGGGCTAAACCTTCCCTGGAGACCCCAATGATAAACCAGCAA
                      ____________________________________________________________
consensus CAGCCAGTTTAGGGCTTCAGGGCTAAACCTTCCCTGGAGACCCCAATGATAAACCAGCGA
 
. : . : . : . : . : . :
rJMSF018H18- GAACTACATACGTGCCAAATGCCATAAATGGGATATACNAATCTGGGGCATTTATGTCAT
JMSF030P08+ GAACAACATACGTGCCAAATGCCATAAATGGGATATACAAATCTGGAGCATTTATGTCAT
                      ____________________________________________________________
consensus GAACTACATACGTGCCAAATGCCATAAATGGGATATACAAATCTGGGGCATTTATGTCAT
 
. : . : . : . : . : . :
rJMSF018H18- AGATTGGGGGCTTATAGGAAAGCCTACCACCTACTGGTTCAGTAATCCTTGTCCAATGAC
JMSF018H18+ ACTGGTTCAGTAATCCTTGTCCAATGAC
JMSF030P08+ AGATTGGGGGCTTATAGGAAAGCCTACCACCTACTGGCTCAGTGATCCTTGTCCAATGAC
                      ____________________________________________________________
consensus AGATTGGGGGCTTATAGGAAAGCCTACCACCTACTGGTTCAGTAATCCTTGTCCAATGAC
 
. : . : . : . : . : . :
rJMSF018H18- CCCTATGCAGGAACGGG-AAAGTACAACTTT
JMSF018H18+ CCCTATGCAGGAACGGGAAAAGTACAACTTTCAATTTGTTCCTCACATATTGGTCATTGA
JMSF030P08+ CCCTATGTAGGAATGGGAAAAGTACAACTTTCAATTTGTTCCTCACATATTGGTCATTGA
                      ____________________________________________________________
consensus CCCTATGCAGGAACGGGAAAAGTACAACTTTCAATTTGTTCCTCACATATTGGTCATTGA
 
. : . : . : . : . : . :
JMSF018H18+ CTTGGAAGTAGTATTGGGGATCAGAAAAGTATCTACTAATATTGCTTTGTACGTATTCAG
JMSF030P08+ CTTGGAAGTAGTATTGGGGATCAGAAAAGTATCTACTAATATTGCTTTGTACGTATTCAG
                      ____________________________________________________________
consensus CTTGGAAGTAGTATTGGGGATCAGAAAAGTATCTACTAATATTGCTTTGTACGTATTCAG
 
. : . : . : . : . : . :
JMSF018H18+ AGCTTGAACCAAGAATTTTCTCTCCATAGGCACCTAATCCACCTCTTATTAAACCAGACC
JMSF030P08+ AGCTTGAACCAAGAATTTTCTCTCCATAGGCACCTAATCCACCTCTTATTAAACCAGACC
                      ____________________________________________________________
consensus AGCTTGAACCAAGAATTTTCTCTCCATAGGCACCTAATCCACCTCTTATTAAACCAGACC
 
. : . : . : . : . : . :
JMSF018H18+ CTGCACCATAGAATGCATTTCCAAATGGATTTGGCTGCTGCATAGTAGGCGGTATAGGAA
JMSF030P08+ CTGCACCATAGAATGCATTTCCAAATGGATTTGGCTGCTGCATAGTAGGCGGTCTAGGAA
                      ____________________________________________________________
consensus CTGCACCATAGAATGCATTTCCAAATGGATTTGGCTGCTGCATAGTAGGCGGTCTAGGAA
 
. : . : . : . : . : . :
JMSF018H18+ CACCAGCCTGTGCTCCAAGATTATCATACATATCT
JMSF030P08+ CTCCAGACTGTGCTCCAAGATTATCATACATATCTCCACAGATCTAAAACGGGCACGCTT
                      ____________________________________________________________
consensus CTCCAGCCTGTGCTCCAAGATTATCATACATATCTCCACAGATCTAAAACGGGCACGCTT
 
. : . : . : . : . : . :
JMSF030P08+ TTCGCTGAAATGAAAAAAATTTCCTTTATGTCTTGATATCTCAATAAGTCAATGAAGAGC
                      ____________________________________________________________
consensus TTCGCTGAAATGAAAAAAATTTCCTTTATGTCTTGATATCTCAATAAGTCAATGAAGAGC
 
. : . : . : . : . : . :
JMSF030P08+ TGAAAAGAAGAAGACAAGGAAGCTAGGGATCGGAATCCGCAGAGCGAGGAGAATTTGGAA
                      ____________________________________________________________
consensus TGAAAAGAAGAAGACAAGGAAGCTAGGGATCGGAATCCGCAGAGCGAGGAGAATTTGGAA
 
. : . : . : . : . : . :
JMSF030P08+ ACCGTGTATGGGTCGATGGCTTCAGTCGATCTGAACCCGATTGTTCCGTGGATCACATTC
                      ____________________________________________________________
consensus ACCGTGTATGGGTCGATGGCTTCAGTCGATCTGAACCCGATTGTTCCGTGGATCACATTC