Previous Contig 006700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004P02Sequence343006700 (4)428012075 (2)
JMSF019F22Sequence247006700 (4)745012075 (2)
JMSF030O22Sequence597006700 (4)637006700 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030O22- CATTCACCAACAAAG
                      ____________________________________________________________
consensus CATTCACCAACAAAG
 
. : . : . : . : . : . :
rJMSF030O22- ATGAACGCTACGGCAAAATCTGCATTATTTACAACTATCCAAAAGATCTCAACAGTCTAC
                      ____________________________________________________________
consensus ATGAACGCTACGGCAAAATCTGCATTATTTACAACTATCCAAAAGATCTCAACAGTCTAC
 
. : . : . : . : . : . :
rJMSF030O22- AACTAGGTAGGCACACAGGCCATAAACCAACGGGAGAGCTATGCTAACAGGCACTAGACT
                      ____________________________________________________________
consensus AACTAGGTAGGCACACAGGCCATAAACCAACGGGAGAGCTATGCTAACAGGCACTAGACT
 
. : . : . : . : . : . :
rJMSF030O22- GCGCACTCGCCTAGACATCACCTCATTCGCTTATCCAACCAAAACAACGCTAACATAAGT
                      ____________________________________________________________
consensus GCGCACTCGCCTAGACATCACCTCATTCGCTTATCCAACCAAAACAACGCTAACATAAGT
 
. : . : . : . : . : . :
rJMSF030O22- TAGGCTCAACACAAAAACCAAGTTACCGGGAACCATCTTCCTTCGTCTTCTTCACGCGAT
                      ____________________________________________________________
consensus TAGGCTCAACACAAAAACCAAGTTACCGGGAACCATCTTCCTTCGTCTTCTTCACGCGAT
 
. : . : . : . : . : . :
rJMSF030O22- GCTACTGCTCCCGCGGGTGGAACACGGTGAGAGCCACCACCCGCGCCTACTCTACTTCGC
                      ____________________________________________________________
consensus GCTACTGCTCCCGCGGGTGGAACACGGTGAGAGCCACCACCCGCGCCTACTCTACTTCGC
 
. : . : . : . : . : . :
rJMSF030O22- CGGAGCTACCACGACGCCGGAGGAGGAGCTCAACGGAGGTGCGGATGTTCTGTTCAAAGG
                      ____________________________________________________________
consensus CGGAGCTACCACGACGCCGGAGGAGGAGCTCAACGGAGGTGCGGATGTTCTGTTCAAAGG
 
. : . : . : . : . : . :
rJMSF030O22- GGAGAAAGGTCCCCGCCTCAAGCTCTGTTCCGTCGCCGCCGATCCACCACCGTATCGCCG
                      ____________________________________________________________
consensus GGAGAAAGGTCCCCGCCTCAAGCTCTGTTCCGTCGCCGCCGATCCACCACCGTATCGCCG
 
. : . : . : . : . : . :
rJMSF030O22- GTTTGCTTCGCCAAAGATCGCAGCTTGCCGAAGCTCTTCCTCTTCTACCGAATGGAGGAG
JMSF030O22+ CCAAAGATCGCAGCTTGCCGAAGCTCTTCCTCTTCTACCGAATGGAGGAG
                      ____________________________________________________________
consensus GTTTGCTTCGCCAAAGATCGCAGCTTGCCGAAGCTCTTCCTCTTCTACCGAATGGAGGAG
 
. : . : . : . : . : . :
rJMSF030O22- ACAACGAGGGCTTGGTCACCGGAGCTTCACCACCACCTCACCACTGTTGTTCGTTGCTGC
JMSF030O22+ ACAACGAGGGCTTGGTCACCGGAGCTTCACCACCACCTCACCACTGTTGTTCGTTGCTGC
                      ____________________________________________________________
consensus ACAACGAGGGCTTGGTCACCGGAGCTTCACCACCACCTCACCACTGTTGTTCGTTGCTGC
 
. : . : . : . : . : . :
rJMSF030O22- TTGGGGTACGCCGGAGGTTCGCCAAAGCCGCTACTTGCCGATGATGCTCAACACTTCTAC
JMSF019F22+ CTTGCCGAAGATGCTCTACACTTCTAC
JMSF004P02+ CTTGCCGAAGATGCTCTACACTTCTAC
JMSF030O22+ TTGGGGTACGCCGGAGGTTCGCCAAAGCCGCTACTTGCCGATGATGCTCAACACTTCTAC
                      ____________________________________________________________
consensus TTGGGGTACGCCGGAGGTTCGCCAAAGCCGCTACTTGCCGATGATGCTCAACACTTCTAC
 
. : . : . : . : . : . :
rJMSF030O22- AAGAGGTCACGAGAAGAGCTAA
JMSF019F22+ AAGAGGTCACGAGAAGAGCTAAGGAGAAGGGGGAGGATGGGATGGCTTGATGTTGGTTGC
JMSF004P02+ AAGAGGTCACGAGAAGAGCTAAGGAGAAGGGGGAGGATGGGATGGCTTGATGTTGGTTGC
JMSF030O22+ AAGAGGTCACGAGAAGAGCTAAGGAGAA-GGGAAAGATGGGATGGCTTGATGTTGGTTGC
                      ____________________________________________________________
consensus AAGAGGTCACGAGAAGAGCTAAGGAGAAGGGGGAGGATGGGATGGCTTGATGTTGGTTGC
 
. : . : . : . : . : . :
JMSF019F22+ AGCTTTAAACCGAGAGAGAGAGACGAAGAGGTGGGGTTGCTTGGCTGCTACAGCTTGTCG
JMSF004P02+ AGCTTTAAACCGAGAGAGAGAGACGAAGAGGTGGGGTTGCTTGGCTGCTACAGCTTGTCG
JMSF030O22+ AGCTTTAAACCGAGAGAGAGAGACGAAGAGGAGAGGTTGCTTGGCTGCTACTGCTTGTCG
                      ____________________________________________________________
consensus AGCTTTAAACCGAGAGAGAGAGACGAAGAGGTGGGGTTGCTTGGCTGCTACAGCTTGTCG
 
. : . : . : . : . : . :
JMSF019F22+ AAGAAGGAAGAAGGAAATGAGGTTGTTTGGTTCGTTCTTGACAAAGCCAATAGGGAGAGG
JMSF004P02+ AAGAAGGAAGAAGGAAATGAGGTTGTTTGGTTCGTTCTTGACAAAGCCAATAGGGAGAGG
JMSF030O22+ AAGAAGGAAGAAGGAAATGGGGTTATTTGGTTCGTTCGTGACAAAGTCGATAGGGAGAGG
                      ____________________________________________________________
consensus AAGAAGGAAGAAGGAAATGAGGTTGTTTGGTTCGTTCTTGACAAAGCCAATAGGGAGAGG
 
. : . : . : . : . : . :
JMSF019F22+ AGGTGCTTGAGCTAAGAACTCGGCT
JMSF004P02+ AGGTGCTTGAGCTAAGAACTCGGCTGCTTGGATTATAGATGATACAATGC
JMSF030O22+ AGGTGCTGGAGTTAAGATCTCGGCTGCTTGGATTATTGATGATACAATGCATACACACAC
                      ____________________________________________________________
consensus AGGTGCTTGAGCTAAGAACTCGGCTGCTTGGATTATTGATGATACAATGCATACACACAC
 
. : . : . : . : . : . :
JMSF030O22+ AAGAGATGGTAGGGTTCACTCACTAGATTGGGTTTAGGTTAGATGGGTTGGGTTTAAACC
                      ____________________________________________________________
consensus AAGAGATGGTAGGGTTCACTCACTAGATTGGGTTTAGGTTAGATGGGTTGGGTTTAAACC