Previous Contig 006695:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043N23Sequence609006695 (2)pir|D96589|D965897e-42hypothetical protein T22H22.15 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMSF030N13Sequence673006695 (2)pir|D96589|D965892e-42hypothetical protein T22H22.15 [imported] - Arabidopsis thaliana>gb:AE005173_893691012743 (2)gb:LES278765_16845445e-53Lycopersicon esculentum mRNA for putative sugar transporter (st3 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030N13+ ACTAGGTATAGTT
                      ____________________________________________________________
consensus ACTAGGTATAGTT
 
. : . : . : . : . : . :
JMFF043N23+ CTAGAGCCAGGTTTCGCCAGGCGAAGAAATTCCCAAAGAAGAACATCAGTGAAAAG
JMSF030N13+ CCAACTAGAGCCAGGTTTCGCCAGGCGAAGAAATTCCCAAAGAAGAACATCAGTGAAAAG
                      ____________________________________________________________
consensus CCAACTAGAGCCAGGTTTCGCCAGGCGAAGAAATTCCCAAAGAAGAACATCAGTGAAAAG
 
. : . : . : . : . : . :
JMFF043N23+ CCAATGGATACTGAAAACGTAATAGCAGCTGTAAATCCCCCTCGATTATTCTTCGGTGTA
JMSF030N13+ CCAATGGATACTGAAAACGTAATAGCAGCTGTAAATCCCCCTCGANTATTNTTCGGTGTA
                      ____________________________________________________________
consensus CCAATGGATACTGAAAACGTAATAGCAGCTGTAAATCCCCCTCGATTATTCTTCGGTGTA
 
. : . : . : . : . : . :
JMFF043N23+ ATTTCTGCAATGTATATAGGTGCCACATAACAATGAAGTCCAGCTCCAATTCCCATCAAT
JMSF030N13+ ATTTCTGCAATGTATATAGGTGCCACATAACAATGAAGTCCAGCTCCAATTCCCATCAAT
                      ____________________________________________________________
consensus ATTTCTGCAATGTATATAGGTGCCACATAACAATGAAGTCCAGCTCCAATTCCCATCAAT
 
. : . : . : . : . : . :
JMFF043N23+ AGTCTTCCAATATTAAGCCACCAAATATTCTTTGCAAATATAATTAAAACCCATCCAACG
JMSF030N13+ AGTCTTCCAATATTAAGCCACCAAATATTCTTTGCAAATATAATTAAAACCCATCCAACG
                      ____________________________________________________________
consensus AGTCTTCCAATATTAAGCCACCAAATATTCTTTGCAAATATAATTAAAACCCATCCAACG
 
. : . : . : . : . : . :
JMFF043N23+ ATGAAGAATATTTCCAAGAACCACATTGTAAGTCTTCGACCAATGGTTTCTGCTATTCTG
JMSF030N13+ ATGAAGAATATTTCCAAGAACCNCATNGTAAGTCTTCGACCAATGGTTTCTGCTATTNTG
                      ____________________________________________________________
consensus ATGAAGAATATTTCCAAGAACCACATTGTAAGTCTTCGACCAATGGTTTCTGCTATTCTG
 
. : . : . : . : . : . :
JMFF043N23+ CCACTTATTAGAGCCCCAATCATTCCTCCAAATGTCAATATTGAACCAAAAGCTGAGTAT
JMSF030N13+ CCACTTATTAGAGCCCCAATCATTCCTCCAAATGTCAATATTGAACCAAAAGCTGAGTAT
                      ____________________________________________________________
consensus CCACTTATTAGAGCCCCAATCATTCCTCCAAATGTCAATATTGAACCAAAAGCTGAGTAT
 
. : . : . : . : . : . :
JMFF043N23+ TCTGCAATAGACAGGCTTAGGTCATCCATGATGCCAAATTCAGCAGGAGATGAATATCCA
JMSF030N13+ TCTGCAATAGACAGGCTTAGGTCATCCATGATGCCAAATTCAGCAGGAGATGAATATCCA
                      ____________________________________________________________
consensus TCTGCAATAGACAGGCTTAGGTCATCCATGATGCCAAATTCAGCAGGAGATGAATATCCA
 
. : . : . : . : . : . :
JMFF043N23+ ACAGAGAAACCATAAGCTAAAGAACCACTGGCAGCAACAATGGTACATAGGACAACAACA
JMSF030N13+ ACAGAGAAACCATAAGCTAAAGAACCACTGGCAGCAACAATGGTACATAGGACAACAACA
                      ____________________________________________________________
consensus ACAGAGAAACCATAAGCTAAAGAACCACTGGCAGCAACAATGGTACATAGGACAACAACA
 
. : . : . : . : . : . :
JMFF043N23+ AATGTTATCTCTGCTGCACTTTCACCATTGTTTCCATCTAGCAAGCCTTCTTCCACGCCC
JMSF030N13+ AATGTTATCTCTGNTGCACTTTCACCATTGTTTCCATCTAGCAAGCCTTCTTCCACGCCC
                      ____________________________________________________________
consensus AATGTTATCTCTGCTGCACTTTCACCATTGTTTCCATCTAGCAAGCCTTCTTCCACGCCC
 
. : . : . : . : . : . :
JMFF043N23+ TCTCTTTCTTGCATCT
JMSF030N13+ TCTCTNTCTTGCATCTNTGATTGAATAGATAGCTCCAATATTGTTGTGTGAAGATGCAAT
                      ____________________________________________________________
consensus TCTCTTTCTTGCATCTNTGATTGAATAGATAGCTCCAATATTGTTGTGTGAAGATGCAAT
 
. : . : . : . : . : . :
JMSF030N13+ CTTTTACAGAGGAAAGAGAAACTCNGACGAAGAGATAGATAGAAAGGGAGAGAGTATNCC
                      ____________________________________________________________
consensus CTTTTACAGAGGAAAGAGAAACTCNGACGAAGAGATAGATAGAAAGGGAGAGAGTATNCC