Previous Contig 006694:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032J13Sequence422006694 (3)gb:AY072822_15674061e-23Gossypium hirsutum putative serine carboxypeptidase precursor (SCP) mRNA, comple661011080 (3)gb:TCA313514_17248615e-66Theobroma cacao mRNA for carboxypeptidase type III (CP-III gene).
JMFF051G01Sequence635006694 (3)gb:AY072822_15674062e-60Gossypium hirsutum putative serine carboxypeptidase precursor (SCP) mRNA, comple511011080 (3)gb:TCA313514_17248616e-39Theobroma cacao mRNA for carboxypeptidase type III (CP-III gene).
JMSF030N04Sequence643006694 (3)gb:AY072822_15674064e-54Gossypium hirsutum putative serine carboxypeptidase precursor (SCP) mRNA, comple711011080 (3)pir|T48977|T489772e-75carboxypeptidase-like protein F14D17.80 [imported] - Arabidopsis thaliana>gb:ATF

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051G01+ CGTAGAGATCATTGCTGACACCATTTTCATCGTGACG
                      ____________________________________________________________
consensus CGTAGAGATCATTGCTGACACCATTTTCATCGTGACG
 
. : . : . : . : . : . :
JMFF051G01+ TAAATCATCTTCATCTGAACTATAGCTGAAACCCGTCCCGGTTGG-TGATCNCACATATA
JMSF030N04+ GAACTATAGCTGAAACCCGTCCCGGTTGGTTGATC-CACATATA
                      ____________________________________________________________
consensus TAAATCATCTTCATCTGAACTATAGCTGAAACCCGTCCCGGTTGGTTGATCNCACATATA
 
. : . : . : . : . : . :
JMFF051G01+ TAAGGTTAGAAATCTTGTCCCAACCATAATCATTCCATATGAGAGACATGTTGTTTGCAA
JMSF030N04+ TAAGGTTAGAAATCTTGTCCCAACCATAATCATTCCATATGAGAGACATGTTGTTTGCAA
                      ____________________________________________________________
consensus TAAGGTTAGAAATCTTGTCCCAACCATAATCATTCCATATGAGAGACATGTTGTTTGCAA
 
. : . : . : . : . : . :
JMFF051G01+ TGTGAAAAGGTCCATTCTCATAGAACAAAGCCAATTCACTACTGCATCCTGGTCCTCCGG
JMFF032J13+ CGG
JMSF030N04+ TGTGAAAAGGTCCATTCTCATAGAACAAAGCCAATTCACTACTGCATCCTGGTCCTCCGG
                      ____________________________________________________________
consensus TGTGAAAAGGTCCATTCTCATAGAACAAAGCCAATTCACTACTGCATCCTGGTCCTCCGG
 
. : . : . : . : . : . :
JMFF051G01+ TTAGCCATATAACCACCGGGTCTTTCTTGCTGCTTCTTGATTCAAAGAAGAAGTAGAACA
JMFF032J13+ TTAGCCATATAACCACCGGGTCTTTCTTGCTGCTTCTTGATTCAAAGAAGAAGTAGAACA
JMSF030N04+ TTAGCCATATAACCACCGGGTCTTTCTTGCTGCTTCTTGATTCAAAGAAGAAGTAGAACA
                      ____________________________________________________________
consensus TTAGCCATATAACCACCGGGTCTTTCTTGCTGCTTCTTGATTCAAAGAAGAAGTAGAACA
 
. : . : . : . : . : . :
JMFF051G01+ TCCTTGCATCTTTAGTATGTGGGAGCCTATAGTAACCGGCATGATGTCCCAGGTCTTCCA
JMFF032J13+ TCCTTGCATCTTTAGTATGTGGGAGCCTATAGTAACCGGCATGATGTCCCAGGTCTTCCA
JMSF030N04+ TCCTTGCATCTTTAGTATGTGGGAGCCTATAGTAACCGGCATGATGTCCCAGGTCTTCCA
                      ____________________________________________________________
consensus TCCTTGCATCTTTAGTATGTGGGAGCCTATAGTAACCGGCATGATGTCCCAGGTCTTCCA
 
. : . : . : . : . : . :
JMFF051G01+ CGGAAGCCCCAGGGTTTCCCAGGTAGTCGAACTTGAAACGCCTCTCGGCGAGTCTGGGCT
JMFF032J13+ CGGAAGCCCCAGGGTTTCCCAGGTAGTCGAACTTGAAACGCCTCTCGGCGAGTCTGGGCT
JMSF030N04+ CGGAAGCCCCAGGGTTTCCCAGGTAGTCGAACTTGAAACGCCTCTCGGCGAGTCTGGGCT
                      ____________________________________________________________
consensus CGGAAGCCCCAGGGTTTCCCAGGTAGTCGAACTTGAAACGCCTCTCGGCGAGTCTGGGCT
 
. : . : . : . : . : . :
JMFF051G01+ GGTCGGCGGCGGCCCCCGGAGGATGCTTGGCGGCGGCGAGATGGTGGCGGCCGGGGATCA
JMFF032J13+ GGTCGGCGGCGGCCCCCGGAGGATGCTTGGCGGCGGCGAGATGGTGGCGGCCGGGGATCA
JMSF030N04+ GGTCGGCGGCGGCCCCCGGAGGATGCTTGGCGGCGGCGAGATGGTGGCGGCCGGGGATCA
                      ____________________________________________________________
consensus GGTCGGCGGCGGCCCCCGGAGGATGCTTGGCGGCGGCGAGATGGTGGCGGCCGGGGATCA
 
. : . : . : . : . : . :
JMFF051G01+ GGTTGAGTCCCCTGATCAACTTCTCGGCTTGGCCAATAGGGAACTGCGGATTCGAGGACG
JMFF032J13+ GGTTGAGTCCCCTGATCAACTTCTCGGCTTGGCCAATAGGGAACTGCGGATTCGAGGACG
JMSF030N04+ GGTTGAGTCCCCTGATCAACTTCTCGGCTTGGCCAATAGGGAACTGCGGATTCGAGGACG
                      ____________________________________________________________
consensus GGTTGAGTCCCCTGATCAACTTCTCGGCTTGGCCAATAGGGAACTGCGGATTCGAGGACG
 
. : . : . : . : . : . :
JMFF051G01+ CAAAGAAACCATCCTTTTCTGCAGACGAAAAGATCGCCACACAAAAGAGAAGTAGCAGAA
JMFF032J13+ CAAAGAAACCATCCTTTTCTGCAGACGAAAAGATCGCCACACAAAAGAGAAGTAGCAGAA
JMSF030N04+ CAAAGAAACCATCCTTTTCTGCAGACGAAAAGATCGCCACACAAAAGAGAAGTAGCAGAA
                      ____________________________________________________________
consensus CAAAGAAACCATCCTTTTCTGCAGACGAAAAGATCGCCACACAAAAGAGAAGTAGCAGAA
 
. : . : . : . : . : . :
JMFF051G01+ GAAGAAAGCAAGAAGAAGAAGAAGGAGTTAGAGAGAGATTTGGTGCCATTTCTCTTT
JMFF032J13+ GAAGAAAGCAAGAAGAAGAAGAAGGAGTTAGAGAGAGATTTGGTGCCATTTCTCTTT
JMSF030N04+ GAAGAAAGCAAGAAGAAGAAGAAGGAGTTAGAGAGAGATTTGGTGCCATTTCTCTTTGTG
                      ____________________________________________________________
consensus GAAGAAAGCAAGAAGAAGAAGAAGGAGTTAGAGAGAGATTTGGTGCCATTTCTCTTTGTG
 
. : . : . : . : . : . :
JMSF030N04+ TTGAAGTGCAAGTTATGGTTGAGATTTATAAAGGGAGTGAGGGGTGGAGTAAGAAATGTC
                      ____________________________________________________________
consensus TTGAAGTGCAAGTTATGGTTGAGATTTATAAAGGGAGTGAGGGGTGGAGTAAGAAATGTC