Previous Contig 006691:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023H22Sequence283001146 (3)735006691 (3)gb:NTA344534_16913504e-81Nicotiana tabacum mRNA for cullin 1B (cul1B gene).
JMSF030L17Sequence460006691 (3)gb:NTA344534_16913508e-36Nicotiana tabacum mRNA for cullin 1B (cul1B gene).418006691 (3)gb:NTA344534_16913507e-36Nicotiana tabacum mRNA for cullin 1B (cul1B gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023H22+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
rJMFF023H22+ GGAACATGCAACATAAATGGAAAGTTTGAGCAAAAAACCATTGAACTGATTTTGGGAACA
                      ____________________________________________________________
consensus GGAACATGCAACATAAATGGAAAGTTTGAGCAAAAAACCATTGAACTGATTTTGGGAACA
 
. : . : . : . : . : . :
rJMFF023H22+ TATCAGGCAGCTGCATTGTTACTCTTCAATGCCTCAGATAGACTAAGTTACCAAGATATT
                      ____________________________________________________________
consensus TATCAGGCAGCTGCATTGTTACTCTTCAATGCCTCAGATAGACTAAGTTACCAAGATATT
 
. : . : . : . : . : . :
rJMFF023H22+ AAAAGCCAGCTAAACTTGGCTGATGATGACTTGGTCAGATTGCTACAGTCTCTTTCATGC
                      ____________________________________________________________
consensus AAAAGCCAGCTAAACTTGGCTGATGATGACTTGGTCAGATTGCTACAGTCTCTTTCATGC
 
. : . : . : . : . : . :
rJMFF023H22+ GCCAAATATAAAATTCTGATTAAGGAACCTAGCAATAGAACCGTTTCGTCCAATGATTAT
                      ____________________________________________________________
consensus GCCAAATATAAAATTCTGATTAAGGAACCTAGCAATAGAACCGTTTCGTCCAATGATTAT
 
. : . : . : . : . : . :
rJMFF023H22+ TTTGAGTTCAACTCCAAATTTACTGACAGAATGAGGAGAATCAGGATACCTCTGCCTCCT
                      ____________________________________________________________
consensus TTTGAGTTCAACTCCAAATTTACTGACAGAATGAGGAGAATCAGGATACCTCTGCCTCCT
 
. : . : . : . : . : . :
rJMFF023H22+ GTGGATGAAAGGAAAAAAGTGGTGGAGGATGTCGACAAGGATAGGCGTTATGCTATTGAT
rJMSF030L17+ TGGAGGATGTCGACAAGGATAGGCGTTATGCTATTGAT
JMSF030L17- TGGAGGATGTCGACAAGGATAGGCGTTATGCTATTGAT
                      ____________________________________________________________
consensus GTGGATGAAAGGAAAAAAGTGGTGGAGGATGTCGACAAGGATAGGCGTTATGCTATTGAT
 
. : . : . : . : . : . :
rJMFF023H22+ GCATGTATTGTACGAATCATGAAGAGTAGAAAAGTTCTGGCTCATCAACAGTTGGCTTTG
rJMSF030L17+ GCATGTATTGTACGAATCATGAAGAGTAGAAAAGTTCTGGCTCATCAACAGTTGGTTTTG
JMSF030L17- GCATGTATTGTACGAATCATGAAGAGTAGAAAAGTTCTGGCTCATCAACAGTTGGTTTTG
                      ____________________________________________________________
consensus GCATGTATTGTACGAATCATGAAGAGTAGAAAAGTTCTGGCTCATCAACAGTTGGTTTTG
 
. : . : . : . : . : . :
rJMFF023H22+ GAGTGTGTTGAGCAGTTGAGTCGAATGTTCAAGCCCGACTTCAAGGCAATCAAGAAGCGA
rJMSF030L17+ GAGTGTGTTGAGCAGTTGAGTCGAATGTTCAAGCCCGACTTCAAGGCAATCAAGAAGCGA
JMSF030L17- GAGTGTGTTGAGCAGTTGAGTCGAATGTTCAAGCCCGACTTCAAGGCAATCAAGAAGCGA
                      ____________________________________________________________
consensus GAGTGTGTTGAGCAGTTGAGTCGAATGTTCAAGCCCGACTTCAAGGCAATCAAGAAGCGA
 
. : . : . : . : . : . :
rJMFF023H22+ ATTGAAGATCTAATAACTCGGGACTACTTGGAACGAGACAAAGAGAACCCGAACATGTTC
rJMSF030L17+ ATTGAAGATCTAATAACTCGGGACTACTTGGAACGAGACAAAGAGAACCCGAACATGTTC
JMSF030L17- ATTGAAGATCTAATAACTCGGGACTACTTGGAACGAGACAAAGAGAACCCGAACATGTTC
                      ____________________________________________________________
consensus ATTGAAGATCTAATAACTCGGGACTACTTGGAACGAGACAAAGAGAACCCGAACATGTTC
 
. : . : . : . : . : . :
rJMFF023H22+ AGGTACCTGGCGTAAATGGAGCTGCATTGGCAAGGCGCTGCTGCTGAATGTTTCTAGGAG
rJMSF030L17+ AGGTACCTGGCGTAAATGGAGCTGCATTGGCAAGGCGCTGCTGCTGAATGTTTCTAGGAG
JMSF030L17- AGGTACCTGGCGTAAATGGAGCTGCATTGGCAAGGCGCTGCTGCTGAATGTTTCTAGGAG
                      ____________________________________________________________
consensus AGGTACCTGGCGTAAATGGAGCTGCATTGGCAAGGCGCTGCTGCTGAATGTTTCTAGGAG
 
. : . : . : . : . : . :
rJMFF023H22+ AAATTGCCCTCGAGTATTTGGTTTTACAGTATAGGTTATTATTTGGTTGTAGTTGGTTAG
rJMSF030L17+ AAATTGCCCTCGAGTATTTGGTTTTACAGTATAGGTTATTATTTGGTTGTAGTTGGTTAG
JMSF030L17- AAATTGCCCTCGAGTATTTGGTTTTACAGTATAGGTTATTATTTGGTTGTAGTTGGTTAG
                      ____________________________________________________________
consensus AAATTGCCCTCGAGTATTTGGTTTTACAGTATAGGTTATTATTTGGTTGTAGTTGGTTAG
 
. : . : . : . : . : . :
rJMFF023H22+ TGCATTTTGTGTTTTTGAACTCGAGCCTCTAAAATAGAGCAAGCTGGTGCTGTGAATAGA
rJMSF030L17+ TGCATTTTGTGTTTTTGAACTCGAGCCTCTAAAATAGAGCAAGCTGGTGCTGTGAATAGA
JMSF030L17- TGCATTTTGTGTTTTTGAACTCGAGCCTCTAAAATAGAGCAAGCTGGTGCTGTGAATAGA
                      ____________________________________________________________
consensus TGCATTTTGTGTTTTTGAACTCGAGCCTCTAAAATAGAGCAAGCTGGTGCTGTGAATAGA
 
. : . : . : . : . : . :
rJMFF023H22+ TGGAAATCATATT
rJMSF030L17+ TGGAAATCATATT
JMSF030L17- TGGAAATCATATTACTTTAATGCTCCTATTATTAGTATATTTTACTATTGTCTTCTANNA
                      ____________________________________________________________
consensus TGGAAATCATATTACTTTAATGCTCCTATTATTAGTATATTTTACTATTGTCTTCTANNA