Previous Contig 006686:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012I18Sequence514006686 (2)gb:AB103113_15264311e-06Arabidopsis thaliana PIL5 premature mRNA for PIF3 like basic Helix Loop Helix pr779011698 (2)gb:HSU63332_20253715e-15Human super cysteine rich protein mRNA, partial cds.
JMSF030K15Sequence663006686 (2)gb:AB103113_15264313e-16Arabidopsis thaliana PIL5 premature mRNA for PIF3 like basic Helix Loop Helix pr784011698 (2)gb:HSU63332_20253715e-15Human super cysteine rich protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030K15+ GCG
                      ____________________________________________________________
consensus GCG
 
. : . : . : . : . : . :
JMSF030K15+ TAGACGGGAGCACACGAAGCTGGTGGATACAGCAAATCGGCATAGAGATCACGGTCAAAC
                      ____________________________________________________________
consensus TAGACGGGAGCACACGAAGCTGGTGGATACAGCAAATCGGCATAGAGATCACGGTCAAAC
 
. : . : . : . : . : . :
JMSF030K15+ GAGGGCTCTTCGAGAGGGTAGTGAAGCCACGACGCCATCTCATCCTCCTGCATGAACACA
                      ____________________________________________________________
consensus GAGGGCTCTTCGAGAGGGTAGTGAAGCCACGACGCCATCTCATCCTCCTGCATGAACACA
 
. : . : . : . : . : . :
JMSF012I18+ TTCGCCGCCGTTTCTTCTCCCGCCGGTCGAATCTCCTTGGTGACAGGCTGCTCA
JMSF030K15+ TGCTGATTCGCCGCCGTTTCTTCTCCCGCCGGTCGAATCTCCTTGGTGACAGGCTGCTCA
                      ____________________________________________________________
consensus TGCTGATTCGCCGCCGTTTCTTCTCCCGCCGGTCGAATCTCCTTGGTGACAGGCTGCTCA
 
. : . : . : . : . : . :
JMSF012I18+ GCCGGAATCGCGGCATCCCCGGAAAAGTGAGATTTATGAAAAGATCTGTGGTTTTGACTA
JMSF030K15+ GCCGGAATCGCGGCATCCCCGGAAAAGTGAGATTTATGAAAAGATCTGTGGTTTTGACTA
                      ____________________________________________________________
consensus GCCGGAATCGCGGCATCCCCGGAAAAGTGAGATTTATGAAAAGATCTGTGGTTTTGACTA
 
. : . : . : . : . : . :
JMSF012I18+ TGCACAACAACTTGACCGTTCTGCCATAGCAGCTCCATGATATCCTCTTCACCCATTGCA
JMSF030K15+ TGCACAACAACTTGACCGTTCTGCCATAGCAGCTCCATGATATCCTCTTCACCCATTGCA
                      ____________________________________________________________
consensus TGCACAACAACTTGACCGTTCTGCCATAGCAGCTCCATGATATCCTCTTCACCCATTGCA
 
. : . : . : . : . : . :
JMSF012I18+ GACTTCTTATGCCTGGTTAAACCAGAGGAAGAAGTAGCGGTGGGAGGAAGATTGAAGTCC
JMSF030K15+ GACTTCTTATGCCTGGTTAAACCAGAGGAAGAAGTAGCGGTGGGAGGAAGATTGAAGTCC
                      ____________________________________________________________
consensus GACTTCTTATGCCTGGTTAAACCAGAGGAAGAAGTAGCGGTGGGAGGAAGATTGAAGTCC
 
. : . : . : . : . : . :
JMSF012I18+ TCATCCATGTCAAAATCCGGAACGCAGTGATTCATCCTCTCTGCAACTCTATAAAAAGCA
JMSF030K15+ TCATCCATGTCAAAATCCGGAACGCAGTGATTCATCCTCTCTGCAACTCTATAAAAAGCA
                      ____________________________________________________________
consensus TCATCCATGTCAAAATCCGGAACGCAGTGATTCATCCTCTCTGCAACTCTATAAAAAGCA
 
. : . : . : . : . : . :
JMSF012I18+ ACTAAAAATCACTTCCTTTTGTTATTTAAAGCTAAAATTCATCATCACTTCCATCCGGAA
JMSF030K15+ ACTAAAAATCACTTCCTTTTGTTATTTAAAGCTAAAATTCATCATCACTTCCATCCGGAA
                      ____________________________________________________________
consensus ACTAAAAATCACTTCCTTTTGTTATTTAAAGCTAAAATTCATCATCACTTCCATCCGGAA
 
. : . : . : . : . : . :
JMSF012I18+ AATCACGATTATGCTTCCCGAAGAACAACAGCTAGCTAGCTATCTAGCTACCCAGATTCA
JMSF030K15+ AATCACGATTATGCTTCCCGAAGAACAACAGCTAGCTAGCTATCTAGCTACCCAGATTCA
                      ____________________________________________________________
consensus AATCACGATTATGCTTCCCGAAGAACAACAGCTAGCTAGCTATCTAGCTACCCAGATTCA
 
. : . : . : . : . : . :
JMSF012I18+ CCGGCCCGCAACAACCCACCGACGATTACAGCCATAGATAAGGAGGTTTTGTTGGGAGAG
JMSF030K15+ CCGGCCCGCAACAACCCACCGACGATTACAGCCATAGATAAGGAGGTTTTGTTGGGAGAG
                      ____________________________________________________________
consensus CCGGCCCGCAACAACCCACCGACGATTACAGCCATAGATAAGGAGGTTTTGTTGGGAGAG
 
. : . : . : . : . : . :
JMSF012I18+ GAGGAGAGGGGGGTTGAGATTCAGAGTAGAATAGAGTA
JMSF030K15+ GAGGAGAGGGGGGTTGAGATTCAGAGTAGAATAGAGTATAAAATCTTCTAGCTTAGCTTC
                      ____________________________________________________________
consensus GAGGAGAGGGGGGTTGAGATTCAGAGTAGAATAGAGTATAAAATCTTCTAGCTTAGCTTC