Previous Contig 006684:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS039E10Sequence617006684 (6)gb:AY500156_16096483e-15Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMSF011D15Sequence206006684 (6)
JMSF030K10Sequence648006684 (6)gb:AY500156_16096488e-18Lycopersicon esculentum MAP3Ka mRNA, complete cds.756013276 (2)gb:AY500156_16096483e-22Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMSF040E20Sequence680006684 (6)gb:AY500156_16096482e-22Lycopersicon esculentum MAP3Ka mRNA, complete cds.862013276 (2)gb:AY500155_16096473e-31Nicotiana benthamiana MAP3Ka mRNA, complete cds.
JMSF044G20Sequence734006684 (6)gb:AY500156_16096481e-25Lycopersicon esculentum MAP3Ka mRNA, complete cds.658024099gb:BNA010091_16332594e-12Brassica napus mRNA for MAP3K alpha 1 protein kinase.
JMSF049P21Sequence648006684 (6)gb:AY500156_16096481e-17Lycopersicon esculentum MAP3Ka mRNA, complete cds.527000640 (61)gb:AF130978_17708331e-41Ipomoea batatas B12D protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044G20+ TTTGACAAAGCAGAAGAGGGG
                      ____________________________________________________________
consensus TTTGACAAAGCAGAAGAGGGG
 
. : . : . : . : . : . :
JMSF044G20+ CTGGTTGGAGAACCTGGTATAAGAGTGGGAGAGGCAGGTGGAAGAGGCAACCGATGGCAT
JMSF040E20+ GGAAGAGGCAACCGATGGCAT
                      ____________________________________________________________
consensus CTGGTTGGAGAACCTGGTATAAGAGTGGGAGAGGCAGGTGGAAGAGGCAACCGATGGCAT
 
. : . : . : . : . : . :
JMSF044G20+ TCACTCTTCCATTCATCCATCCTTCCTGTTGGAGAATCCAAATTAGCACCTCCACAATGG
JMSF049P21+ TTCATCCATCCTTCCTGTTGGAGAATCCAAATTAGCACCTCCACAATGG
JMFS039E10+ ATTCATCCATCNTTCCTG-TGGAGAATCCAAATTAGCACCTCCACAATGG
JMSF040E20+ TCACTCTTCCATTCATCCATCCTTCCTGTTGGAGAATCCAAATTAGCACCTCCACAATGG
JMSF030K10+ ATTCATCCATCCTTCCTGTTGGAGAATCCAAATTAGCACCTCCACAATGG
                      ____________________________________________________________
consensus TCACTCTTCCATTCATCCATCCTTCCTGTTGGAGAATCCAAATTAGCACCTCCACAATGG
 
. : . : . : . : . : . :
JMSF044G20+ GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
JMSF049P21+ GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
JMFS039E10+ GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
JMSF040E20+ GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
JMSF030K10+ GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
                      ____________________________________________________________
consensus GGGTGTCGAGGTGAAGAATTAGTTGTAGGAGCTCTTGAACGGACAGGGCTTTGTGAAACT
 
. : . : . : . : . : . :
JMSF044G20+ GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
JMSF049P21+ GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
JMFS039E10+ GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
JMSF040E20+ GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
JMSF030K10+ GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
                      ____________________________________________________________
consensus GGACTCTGCTTGTTATCTCCAACTCCTCTTAAAGAGGTGAATTGAACACGATCGATGCGG
 
. : . : . : . : . : . :
JMSF044G20+ TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
JMSF049P21+ TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
JMFS039E10+ TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
JMSF040E20+ TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
JMSF030K10+ TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
                      ____________________________________________________________
consensus TTATGATCATCACATGAAGCAGAAGAGCTAACACTCGATCCTGAGTCAGACCCGGATCCG
 
. : . : . : . : . : . :
JMSF044G20+ AACCCGAACCCTAACCCAAGATCATTTCCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
JMSF049P21+ AACCCGAACCCTAACCCAAGATCATTTCCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
JMFS039E10+ AACCCGAACCCTAACCCAAGATCATTTCCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
JMSF040E20+ AACCCGAACCCTAACCCAAGATCATTTCCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
JMSF030K10+ AACCCGAACCCTAACCCAAGATCAT--CCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
                      ____________________________________________________________
consensus AACCCGAACCCTAACCCAAGATCATTTCCAAAAGAAGACACGGACGGCTGCGGCAGCGGA
 
. : . : . : . : . : . :
JMSF044G20+ AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
JMSF049P21+ AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
JMFS039E10+ AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
JMSF040E20+ AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
JMSF030K10+ AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
                      ____________________________________________________________
consensus AGCCCTTTGTCCATAAAAGCAGAAGCAGAACCCGAAGAACCTCGGGCGCTAGAAAAATCT
 
. : . : . : . : . : . :
JMSF044G20+ CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
JMSF049P21+ CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
JMFS039E10+ CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
JMSF040E20+ CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
JMSF030K10+ CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
                      ____________________________________________________________
consensus CTGCTGGTTCTGGGTGAATTCCTCGCGTCCACCATTCCTGATACCTCACCGAGGCTCCTT
 
. : . : . : . : . : . :
JMSF044G20+ GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
JMSF049P21+ GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
JMFS039E10+ GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
JMSF040E20+ GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
JMSF011D15+ ACGCTACTCGGAGATTTGGGGGAATTG
JMSF030K10+ GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
                      ____________________________________________________________
consensus GGTCTATCGCTTCTGTCAATCCTTTCATTCTTGACGCTACTCGGAGATTTGGGGGAATTG
 
. : . : . : . : . : . :
JMSF044G20+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
JMSF049P21+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
JMFS039E10+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
JMSF040E20+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
JMSF011D15+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
JMSF030K10+ AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
                      ____________________________________________________________
consensus AGCTGTGGGTCGTTCGTGATCTTCTTGGCGGATTTTCTCCCCCACCAACCAGGCATTTTT
 
. : . : . : . : . : . :
JMSF044G20+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
JMSF049P21+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
JMFS039E10+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
JMSF040E20+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
JMSF011D15+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
JMSF030K10+ CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
                      ____________________________________________________________
consensus CATGAGCTAACTGCGAGAACAAAAGTGAATTCTACTTATTTATCAGTCTGTGAGGGGAAC
 
. : . : . : . : . : . :
JMSF044G20+ GAGGATATAGGGATATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACC
JMSF049P21+ GAGGATATAGGGATATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACCAAGTCCC
JMFS039E10+ GAGGATATAGGGATATGGGAAGAGAA
JMSF040E20+ GAGGATATAGGGATATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACCAAGTCCC
JMSF011D15+ GAGGATATAGGGGTATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACCAAGTCCC
JMSF030K10+ GAGGATATAGGGATATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACCAAGTCCCA
                      ____________________________________________________________
consensus GAGGATATAGGGATATGGGAAGAGAAGAAGAAGAGAATGAGAGAGATAGACCAAGTCCCA