Previous Contig 006682:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029N08Sequence435006682 (9)gb:AB128915_15283552e-39Gentiana triflora mRNA for peroxiredoxin Q, complete cds.690006682 (9)gb:AY530803_16119092e-81Populus balsamifera subsp. trichocarpa x Populus deltoides peroxiredoxin Q (prxQ
JMFN016F04Sequence605006682 (9)gb:AY530803_16119092e-69Populus balsamifera subsp. trichocarpa x Populus deltoides peroxiredoxin Q (prxQ
JMSF006N10Sequence267006682 (9)
JMSF017H14Sequence418006682 (9)gb:AY530803_16119092e-58Populus balsamifera subsp. trichocarpa x Populus deltoides peroxiredoxin Q (prxQ
JMSF030J23Sequence347006682 (9)gb:AB023041_15154605e-16Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.>gb:AY048264_156291006682 (9)gb:AB023041_15154605e-16Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11.>gb:AY048264_156
JMSF037K20Sequence486019954gb:AK176844_18188322e-33Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-H22.706006682 (9)gb:AY530803_16119091e-79Populus balsamifera subsp. trichocarpa x Populus deltoides peroxiredoxin Q (prxQ
JMSF037L20Sequence652006682 (9)gb:AY530803_16119092e-75Populus balsamifera subsp. trichocarpa x Populus deltoides peroxiredoxin Q (prxQ

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006N10- GGCAATGTTCGTTT
                      ____________________________________________________________
consensus GGCAATGTTCGTTT
 
. : . : . : . : . : . :
JMSF006N10- TCCTCACAAGGAACACANATTCTTTATCATCTTTTTTTTTCCCCAGAAATGGCCACTTTT
JMFF029N08- ATTCTTTATCATCTTTTTTTTTCCCCAGAAATGGCCACTTTT
                      ____________________________________________________________
consensus TCCTCACAAGGAACACANATTCTTTATCATCTTTTTTTTTCCCCAGAAATGGCCACTTTT
 
. : . : . : . : . : . :
JMSF006N10- TCTCTTTCTGCTAATCACATTCTTCCTTCNCTACTCCATGCTCAATCCCCTCAAGCCAAT
JMFF029N08- TCTCTTTCTGCTAATCACATTCTTCCTTCTCTACTCCATGCTCAATCCCCTCAAGCCAAT
JMFN016F04- CTCTTTCTGCTAATCACATTCTTCCTTCTCTACTCCATGCTCAATCCCCTCAAGCCAAT
                      ____________________________________________________________
consensus TCTCTTTCTGCTAATCACATTCTTCCTTCTCTACTCCATGCTCAATCCCCTCAAGCCAAT
 
. : . : . : . : . : . :
JMSF006N10- CTCCCTCAAACCCTCAATTTCGTCCCCAAATCTTCACAATCCCAGTTTTATGGTCTCAAG
JMFF029N08- CTCCCTCAAACCCTCAATTTCGTCCCCAAATCTTCACAATCCCAGTTTTATGGTCTCAAG
JMFN016F04- CTCCCTCAAACCCTCAATTTCGTCCCCAAATCTTCACAATCCCAGTTTTATGGTCTCAAG
rJMFF029N08+ GTCCCCAAATCTTCACAATCCCAGTTTTATGGTCTCAAG
                      ____________________________________________________________
consensus CTCCCTCAAACCCTCAATTTCGTCCCCAAATCTTCACAATCCCAGTTTTATGGTCTCAAG
 
. : . : . : . : . : . :
JMSF006N10- CTTCTCCANGCCTCTTCCCTTTCAAAGCCCTCATTTTCTTCCTCTTCAACAAAAAGCTCC
JMFF029N08- CTTCTCCACGCCTCTTCCCTTTCAAAGCCCTCATTTTCTTCCTCTTCAACAAAAAGCTCC
rJMSF017H14+ TCAAAGCCTTCATNTTCTTCCTCTTCAACAAAAAGCTCC
JMFN016F04- CTTCTCCACGCCTCTTCCCTTTCAAAGCCCTCATTTTCTTCCTCTTCAACAAAAAGCTCC
rJMFF029N08+ CTTCTCCACGCCTCTTCCCTTTCAAAGCCCTCATTTTCTTCCTCTTCAACAAAAAGCTCC
                      ____________________________________________________________
consensus CTTCTCCACGCCTCTTCCCTTTCAAAGCCCTCATTTTCTTCCTCTTCAACAAAAAGCTCC
 
. : . : . : . : . : . :
JMSF006N10- ATTTTTGCTAAGG
JMFF029N08- ATTTTTGCTAAGGTAACTAAGGGTTCAGTGCCACCATCATTTACATTGAAAGATCAAGCT
rJMSF017H14+ ATTTTTGCTAAGGTAACTAAGGGTTCAGNGCCNCCATCATTTACATTGAAAGATCAAGCT
JMFN016F04- ATTTTTGCTAAGGTAACTAAGGGTTCAGTGCCACCATCATTTACATTGAAAGATCAAGCT
rJMFF029N08+ ATTTTTGCTAAGGTAACTAAGGGTTCAGTGCCACCATCATTTACATTGAAAGATCAAGCT
rJMSF037L20+ TTTACATTGAAAGATCAAGAT
rJMSF037K20+ TTTACATTGAAAGATCAAGAT
                      ____________________________________________________________
consensus ATTTTTGCTAAGGTAACTAAGGGTTCAGTGCCACCATCATTTACATTGAAAGATCAAGCT
 
. : . : . : . : . : . :
JMFF029N08- GGAAGAAATGTGACCCTCTCCAAGTTCAAAGGAAAGCCTATTGTGGTTTATTTCTACCCT
rJMSF017H14+ GGAAGAAATGTGACCCTCTCCAAGTTCAAAGGAAAGCCTATTGTGGTTTATTTCTACCCT
JMFN016F04- GGAAGAAATGTGACCCTCTCCAAGTTCAAAGGAAAGCCTATTGTGGTTTATTTCTACCCT
rJMFF029N08+ GGAAGAAATGTGACCCTCTCCAAGTTCAAAGGAAAGCCTATTGTGGTTTATTTCTACCCT
rJMSF037L20+ GGGAGAAATGTGAGCCTGTCCAAGTTCAAAGGCAAGCCTGTGGTGGTCTATTTCTACCCT
rJMSF037K20+ GGGAGAAATGTGAGCCTGTCCAAGTTCAAAGGCAAGCCTGTGGTGGTCTATTTCTACCCT
                      ____________________________________________________________
consensus GGAAGAAATGTGACCCTCTCCAAGTTCAAAGGAAAGCCTATTGTGGTTTATTTCTACCCT
 
. : . : . : . : . : . :
JMFF029N08- GCTGATGACACTCCTGGTTGTACCAAACAGGCCTGTTCATTCAGGGATTCATATGAGAAA
rJMSF017H14+ GCTGATGACANTCCTGGTTGTACCAAACAGGCCTGTTCATTCAGGGATTCATATGAGAAA
JMFN016F04- GCTGATGACACTCCTGGTTGTACCAAACAGGCCTGTTCATTCAGGGATTCATATGAGAAA
rJMFF029N08+ GCTGATGACACTCCTGGTTGTACCAAACAGGCCTGTTCATTCAGGGATTCATATGAGAAA
rJMSF037L20+ GCTGATGAAACTCCTGGCTGCACCAAACAGGCCTGTGCCTTCAGGGACTCTTACGAGAAA
rJMSF037K20+ GCTGATGAAACTCCTGGCTGCACCAAACAGGCCTGTGCCTTCAGGGACTCTTACGAGAAA
                      ____________________________________________________________
consensus GCTGATGACACTCCTGGTTGTACCAAACAGGCCTGTTCATTCAGGGATTCATATGAGAAA
 
. : . : . : . : . : . :
JMFF029N08- TTCAAGAAAGCCGGAGCTGAAGTTGTTGGGA
rJMSF017H14+ TTCAAGAAAGCCGGAGCTGAAGTTGNTGGGATTAGCGGTGATAATCCTTCCTCCCATAAG
JMFN016F04- TTCAAGAAAGCCGGAGCTGAAGTTGTTGGGATTAGCGGTGATAATCCTTCCTCCCATAAG
rJMFF029N08+ TTCAAGAAAGCCGGAGCTGAAGTTGTTGGGATTAGCGGTGATAATCCTTCCTCCCATAAG
rJMSF037L20+ TTCAAGAAAGCAGGAGCTGAAGTTGTCGGGATTAGCGGGGATGATACATCATCCCACAAG
rJMSF037K20+ TTCAAGAAAGCAGGAGCTGAAGTTGTCGGGATTAGCGGGGATGATACATCATCCCACAAG
                      ____________________________________________________________
consensus TTCAAGAAAGCCGGAGCTGAAGTTGTTGGGATTAGCGGTGATAATCCTTCCTCCCATAAG
 
. : . : . : . : . : . :
rJMSF017H14+ GCCTNTGCAGAAAAATACAAACTTCCATTCACGTTGNTAAGTGACGAAGGCAACAATGTA
JMFN016F04- GCCTTTGCAGAAAAATACAAACTTCCATTCACGTTGCTAAGTGACGAAGGCAACAATGTA
rJMFF029N08+ GCCTTTGCAGAAAAATACAAACTTCCATTCACGTTGCTAAGTGACGAAGGCAACAATGTA
rJMSF037L20+ GCCTTTGCCAAGAAATATAGACTTCCATTTACACTGCTAAGTGATGAAGGGGACAAGGTG
rJMSF037K20+ GCCTTTGCCAAGAAATATAGACTTCCATTTACACTGCTAAGTGATGAAGGGGACAAGGTG
                      ____________________________________________________________
consensus GCCTTTGCAGAAAAATACAAACTTCCATTCACGTTGCTAAGTGACGAAGGCAACAATGTA
 
. : . : . : . : . : . :
rJMSF017H14+ AGAAAAGAGTGGGGAGTCCCTGCAGACCTCTTCGGTGCATTGCCTGGGCGACAAACTTAT
JMFN016F04- AGAAAAGAGTGGGGAGTCCCTGCAGACCTCTTCGGTGCATTGCCTGGGCGACAAACTTAT
rJMFF029N08+ AGAAAAGAGTGGGGAGTCCCTGCAGACCTCTTCGGTGCATTGCCTGGGCGACAAACTTAT
rJMSF037L20+ AGGAAAGAGTGGGGAGTCCCCTCAGATCTTTTTGGTGCATTGCCTGGAAGACAGACCTAT
rJMSF037K20+ AGGAAAGAGTGGGGAGTCCCCTCAGATCTTTTTGGTGCATTGCCTGGAAGACAGACCTAT
rJMSF030J23+ GAGTCCCCTCAGATCTTTTTGGTGCATTGCCTGGAAGACAGACCTAT
JMSF030J23- GAGTCCCCTCAGATCTTTTTGGTGCATTGCCTGGAAGACAGACCTAT
                      ____________________________________________________________
consensus AGAAAAGAGTGGGGAGTCCCCTCAGATCTTTTTGGTGCATTGCCTGGAAGACAGACCTAT
 
. : . : . : . : . : . :
rJMSF017H14+ GTTCTTGA
JMFN016F04- GTTCTTGACAAGAA
rJMFF029N08+ GTTCTTGACAAGAAAGGAGTGGTCCAACTCATCTATAACAATCAATTCCAGCCCGAAAAA
rJMSF037L20+ GTTCTTGACAAGAATGGAGTCGTCCAACTCATCTATAACAATCAGTTCCAGCCCGAAAAG
rJMSF037K20+ GTTCTTGACAAGAATGGAGTCGTCCAACTCATCTATAACAATCAGTTCCAGCCCGAAAAG
rJMSF030J23+ GTTCTTGACAAGAATGGAGTCGTCCAACTCATCTATAACAATCAGTTCCAGCCCGAAAAG
JMSF030J23- GTTCTTGACAAGAATGGAGTCGTCCAACTCATCTATAACAATCAGTTCCAGCCCGAAAAG
                      ____________________________________________________________
consensus GTTCTTGACAAGAATGGAGTCGTCCAACTCATCTATAACAATCAGTTCCAGCCCGAAAAG
 
. : . : . : . : . : . :
rJMFF029N08+ CATATTGACGAGACATTGAAGCTACTCCAAAGTCTTTAA
rJMSF037L20+ CATATTGATGAGACTTTGAAGCTCCTTCAAAGTCTTTAATCATACCTCCAAATTCTTTCT
rJMSF037K20+ CATATTGATGAGACTTTGAAGCTCCTTCAAAGTCTTTAATCATACCTCCAAATTCTTTCT
rJMSF030J23+ CATATTGATGAGACTTTGAAGCTCCTTCAAAGTCTTTAATCATACCTCCAAATTCTTTCT
JMSF030J23- CATATTGATGAGACTTTGAAGCTCCTTCAAAGTCTTTAATCATACCTCCAAATTCTTTCT
                      ____________________________________________________________
consensus CATATTGATGAGACTTTGAAGCTCCTTCAAAGTCTTTAATCATACCTCCAAATTCTTTCT
 
. : . : . : . : . : . :
rJMSF037L20+ TATGTTCTTTCTGTATGAGATAGAATATCTTATCTCTCCCTAATTATGTATGTATCTGCC
rJMSF037K20+ TATGTTCTTTCTGTATGAGATAGAATATCTTATCTCTCCCTAATTATGTATGTATCTGCC
rJMSF030J23+ TATGTTCTTTCTGTATGAGATAGAATATCTTATCTCTCCCTAATTATGTATGTATCTGCC
JMSF030J23- TATGTTCTTTCTGTATGAGATAGAATATCTTATCTCTCCCTAATTATGTATGTATCTGCC
                      ____________________________________________________________
consensus TATGTTCTTTCTGTATGAGATAGAATATCTTATCTCTCCCTAATTATGTATGTATCTGCC
 
. : . : . : . : . : . :
rJMSF037L20+ AACACTAATCAAGTGTTCTTGAGTTCTCGAGATTAGTCTAATACTGCCTTACCGGAAATA
rJMSF037K20+ AACACTAATCAAGTGTTCTTGAGTTCTCGAGATTAGTCTAATACTGCCTTACCGGAAATA
rJMSF030J23+ AACACTAATCAAGTGTTCTTGAGTTCTCGAGATTAGTCTAATACTGCCTTACCGGAAATA
JMSF030J23- AACACTAATCAAGTGTTCTTGAGTTCTCGAGATTAGTCTAATACTGCCTTACCGGAAATA
                      ____________________________________________________________
consensus AACACTAATCAAGTGTTCTTGAGTTCTCGAGATTAGTCTAATACTGCCTTACCGGAAATA
 
. : . : . : . : . : . :
rJMSF037L20+ CTAT
rJMSF037K20+ CTAT
rJMSF030J23+ CTAT
JMSF030J23- CTATTCCATAATGAATCTATACTGCAAACTAAACATGCTATTAGTCTCTCANAAAAAAAA
                      ____________________________________________________________
consensus CTATTCCATAATGAATCTATACTGCAAACTAAACATGCTATTAGTCTCTCANAAAAAAAA