Previous Contig 006679:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026C05Sequence491006679 (9)gb:AB007819_15103241e-10Citrus unshiu gene for glycine-rich RNA-binding protein, complete cds.782006679 (9)gb:AF005359_17607932e-18Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN003D19Sequence574006679 (9)gb:AF005359_17607939e-19Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN019M06Sequence625006679 (9)gb:AF005359_17607931e-19Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFS111B02Sequence627006679 (9)gb:AF005359_17607934e-22Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMSF030J03Sequence616006679 (9)gb:AF005359_17607934e-18Nicotiana glutinosa RNA-binding protein mRNA, complete cds.770006679 (9)gb:AF005359_17607932e-18Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMSF035E17Sequence402006679 (9)739007991 (15)gb:AF495716_18055473e-90Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF043N22Sequence431006679 (9)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003D19+ GAAAATGCAAATCAACGTT
                      ____________________________________________________________
consensus GAAAATGCAAATCAACGTT
 
. : . : . : . : . : . :
JMSF043N22+ GAACTTTGTAAATACAGATTTACAAACAAATCGAACCACAGATAA
JMSF035E17+ GAACTTTGTAAATACAGATTTACAAACAAATCGAACCACAGATAA
JMFN003D19+ TACATCATTTCTCGAGAACTTTGTAAATACAGATTTACAAACAAATCGAACCACAGATAA
rJMFF026C05- TCATTCCTCGAGAACTTTGTAAATACAGATTTACAAACAAATCGAACCACAGATAA
rJMSF030J03- GATTTACAAACAAATCGAACCACAGATAA
                      ____________________________________________________________
consensus TACATCATTTCTCGAGAACTTTGTAAATACAGATTTACAAACAAATCGAACCACAGATAA
 
. : . : . : . : . : . :
JMSF043N22+ CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
JMSF035E17+ CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
JMFN003D19+ CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
rJMFF026C05- CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
rJMSF030J03- CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
                      ____________________________________________________________
consensus CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACCATAGCAGAAGGA
 
. : . : . : . : . : . :
JMSF043N22+ CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
JMSF035E17+ CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
JMFN003D19+ CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
rJMFF026C05- CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
rJMSF030J03- CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
                      ____________________________________________________________
consensus CCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACCACGCAACAATAA
 
. : . : . : . : . : . :
JMSF043N22+ AGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
JMSF035E17+ AGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
JMFN003D19+ AGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
rJMFF026C05- AGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
rJMSF030J03- AGCTAGATTAGTTCCTCCAGCTTCCATTATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
                      ____________________________________________________________
consensus AGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGCGGTCACCTCCGC
 
. : . : . : . : . : . :
JMSF043N22+ CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
JMSF035E17+ CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
JMFN003D19+ CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
rJMFF026C05- CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
rJMSF030J03- CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
                      ____________________________________________________________
consensus CGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCGCCAC
 
. : . : . : . : . : . :
JMSF043N22+ CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCACCCTCACGACGTC
JMSF035E17+ CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCC
JMFN003D19+ CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCACCCTCACGACGTC
rJMFF026C05- CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCACCCTCACGACGTC
rJMSF030J03- CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCACCCTCACGACGTC
                      ____________________________________________________________
consensus CACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCACCCTCACGACGTC
 
. : . : . : . : . : . :
JMSF043N22+ CACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACTGAGCCTCGTTAA
JMFN003D19+ CACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACTGAGCCTCGTTAA
rJMFF026C05- CACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACTGAGCCTCGTTAA
rJMSF030J03- CACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACTGAGCCTCGTTAA
JMFN019M06+ CCACGGAAACCGCCACCGCCGCCGCCGCCGCCGGTTCCGCGAGACTGAGCCTCGTTAA
JMFS111B02+ CCGCCGCCGCCGCGCCGGTTTCCGCGAGACTGAGCCTCGTTAA
JMSF030J03+ TGAGCCTCGTTAA
                      ____________________________________________________________
consensus CACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACTGAGCCTCGTTAA
 
. : . : . : . : . : . :
JMSF043N22+ CAGTTATGTTACGCCCGTCAAGAGAC
JMFN003D19+ CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
rJMFF026C05- CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
rJMSF030J03- CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
JMFN019M06+ CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
JMFS111B02+ CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
JMSF030J03+ CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
                      ____________________________________________________________
consensus CAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAGCATCCTTCATTG
 
. : . : . : . : . : . :
JMFN003D19+ CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
rJMFF026C05- CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
rJMSF030J03- CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
JMFN019M06+ CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
JMFS111B02+ CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
JMFF026C05+ CCGGTCTCACGATCGT
JMSF030J03+ CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
                      ____________________________________________________________
consensus CTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGGTCTCACGATCGT
 
. : . : . : . : . : . :
JMFN003D19+ TGATGATCTGATCCA
rJMFF026C05- TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATC-ACCAAATCTACNAGCTA
rJMSF030J03- TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATCAACCAAATCTACAAGCTA
JMFN019M06+ TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATCAACCAAATCTACAAGCTA
JMFS111B02+ TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATCAACCAAATCTACAAGCTA
JMFF026C05+ TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATC-ACCAAATCTACAAGCTA
JMSF030J03+ TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATCAACCAAATCTACAAGCTA
                      ____________________________________________________________
consensus TGATGATCTGATCCACAACAAAATTCAACAACAGTCAGAATCAACCAAATCTACAAGCTA
 
. : . : . : . : . : . :
rJMFF026C05- AAA--ACAATAATAATAGCAACAAACTTAAATACATATATACGTATAGGGGCGAAACACA
rJMSF030J03- AAAACACAATAATAATAGCAACAAACTCAAATACATATATACGTATAGGGGCGAAACACA
JMFN019M06+ AAAACACAATAATAATAGCAACAAACTCAAATACATATATACGTATAGGGGCGAAACACA
JMFS111B02+ AAAACACAATAATAATAGCAACAAACTCAAATACATATATACGTATAGGGGCGAAACACA
JMFF026C05+ AAA--ACAATAATAATAGCAACAAACTTAAATACATATATACGTATAGGGGCGAAACACA
JMSF030J03+ AAAACACAATAATAATAGCAACAAACTCAAATACATATATACGTATAGGGGCGAAACACA
                      ____________________________________________________________
consensus AAAACACAATAATAATAGCAACAAACTCAAATACATATATACGTATAGGGGCGAAACACA
 
. : . : . : . : . : . :
rJMFF026C05- AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
rJMSF030J03- AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
JMFN019M06+ AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
JMFS111B02+ AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
JMFF026C05+ AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
JMSF030J03+ AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
                      ____________________________________________________________
consensus AAAGCGATCGATCTTAACCTCTCAACAGAAAGAGGAAGATGAACGTACCGTTTCAGGGGA
 
. : . : . : . : . : . :
rJMFF026C05- AAGTAATAGTAACCAATAGTAACACNGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
rJMSF030J03- AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
JMFN019M06+ AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
JMFS111B02+ AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
JMFF026C05+ AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
JMSF030J03+ AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
                      ____________________________________________________________
consensus AAGTAATAGTAACAAATAGTAACACAGAGAGAGAGAACAGTAGATCAAAGTAACATAGTA
 
. : . : . : . : . : . :
rJMFF026C05- GTAGTAACA
rJMSF030J03- GTAGTAACAGAGAGATCATGT
JMFN019M06+ GTAGTAACAGAGAGATCATGTCAACAAAGACGAATCGGGTGAAACCGAGATTCGATCACT
JMFS111B02+ GTAGTAACAGAGAGATCATGTCAACAAAGACGAATCGGGTGAAACCGAGATTCGATCACT
JMFF026C05+ GTAGTAACAGAGAGATCATGTCAACAAAGACGAATCGGGTGAAACCGAGATTCGATCACT
JMSF030J03+ GTAGTAACAGAGAGATCATGTCAACAAAGACGAATCGGGTGAAACCGAGATTCGATCACT
                      ____________________________________________________________
consensus GTAGTAACAGAGAGATCATGTCAACAAAGACGAATCGGGTGAAACCGAGATTCGATCACT
 
. : . : . : . : . : . :
JMFN019M06+ GCTCTGAGACAGACAGACCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCATG
JMFS111B02+ GCTCTGAGACAGACAGACCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCATG
JMFF026C05+ GCTCTGAGACAGACAGACCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCATG
JMSF030J03+ GCTCTGAGACAGACAGACCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCATG
                      ____________________________________________________________
consensus GCTCTGAGACAGACAGACCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCATG
 
. : . : . : . : . : . :
JMFN019M06+ TAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTTC
JMFS111B02+ TAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTTC
JMFF026C05+ TAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTTC
JMSF030J03+ TAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTTC
                      ____________________________________________________________
consensus TAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTTC
 
. : . : . : . : . : . :
JMFN019M06+ TGCCATGACTGAAAGGAGAAAATACAA
JMFS111B02+ TGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTA
JMFF026C05+ TGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACG
JMSF030J03+ TGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATCA
                      ____________________________________________________________
consensus TGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATCA