Previous Contig 006676:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012M17Sequence577006676 (6)pir|S31196|S311968e-63hypothetical protein - potato
JMFS034C03Sequence564006676 (6)pir|S31196|S311969e-67hypothetical protein - potato
JMFS102H05Sequence603006676 (6)pir|S31196|S311967e-71hypothetical protein - potato
JMSF030I20Sequence651006676 (6)pir|S31196|S311969e-68hypothetical protein - potato720014033 (3)pir|S31196|S311961e-75hypothetical protein - potato
JMSF034C05Sequence700006676 (6)pir|S31196|S311963e-83hypothetical protein - potato711014033 (3)pir|S31196|S311962e-41hypothetical protein - potato
JMSF052O01Sequence698006676 (6)pir|S31196|S311963e-83hypothetical protein - potato868014033 (3)pir|S31196|S311961e-66hypothetical protein - potato

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052O01+ TTGTACGCAAAATAGGGATACGCATTGATCAGAAAAGGCGAGCTGGTT
JMSF034C05+ TGTACGCAAAATAGGGATACGCATTGATCAGAAAAGGCGAGCTGGTT
                      ____________________________________________________________
consensus TTGTACGCAAAATAGGGATACGCATTGATCAGAAAAGGCGAGCTGGTT
 
. : . : . : . : . : . :
JMSF052O01+ TTGACGTGGAATTCCAGGATCTGGCAAATGCAATCCACTAGATCTCGCCGGAACGCCCCT
JMFS102H05+ GCAAATGCAATCCACTAGATCTCGCCGGAACGCCCCT
JMFS034C03+ GAACGCCCCT
JMSF034C05+ TTGACGTGGAATTCCAGGATCTGGCAAATGCAATCCACTAGATCTCGCCGGAACGCCCCT
JMSF030I20+ GAATTCCAGGATCTGGCAAATGCAATCCACTAGATCTCGCCGGAACGCCCCT
                      ____________________________________________________________
consensus TTGACGTGGAATTCCAGGATCTGGCAAATGCAATCCACTAGATCTCGCCGGAACGCCCCT
 
. : . : . : . : . : . :
JMSF052O01+ GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
JMFS102H05+ GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
JMFF012M17+ GACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
JMFS034C03+ GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
JMSF034C05+ GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
JMSF030I20+ GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
                      ____________________________________________________________
consensus GCGGACGGCGGATACGAAGTCTCCAGCACCGCCAGAGAATGCGCGGTTGTCACCGTCACT
 
. : . : . : . : . : . :
JMSF052O01+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
JMFS102H05+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
JMFF012M17+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
JMFS034C03+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
JMSF034C05+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
JMSF030I20+ TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
                      ____________________________________________________________
consensus TGCTTGTCCAGGTTGAGACTCACCAGAGCGGCGTGAACGCTCTGCATTGCCGGGAGCAGG
 
. : . : . : . : . : . :
JMSF052O01+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
JMFS102H05+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
JMFF012M17+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGANTTCGTTTCCTACGGCGATGCAGGTG
JMFS034C03+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
JMSF034C05+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
JMSF030I20+ TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
                      ____________________________________________________________
consensus TTGCCGGAGAGAGTAGTGTCATTGAAGGTCAGGACTTCGTTTCCTACGGCGATGCAGGTG
 
. : . : . : . : . : . :
JMSF052O01+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
JMFS102H05+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
JMFF012M17+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAACTTTCGCA
JMFS034C03+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
JMSF034C05+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
JMSF030I20+ ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
                      ____________________________________________________________
consensus ATTTTGGTCGCCGGCAAATACGCCTGCACGTTCTGCTTAACCCAAGCTTGAGCTTTCGCA
 
. : . : . : . : . : . :
JMSF052O01+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
JMFS102H05+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
JMFF012M17+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
JMFS034C03+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
JMSF034C05+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
JMSF030I20+ GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
                      ____________________________________________________________
consensus GGATCCTTAATTTTAGACAAGTACTCGTTGGGGACACTGACAATGAACTCCACATTAGTG
 
. : . : . : . : . : . :
JMSF052O01+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
JMFS102H05+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
JMFF012M17+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
JMFS034C03+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
JMSF034C05+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
JMSF030I20+ TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTC-ACCTGGTGGCCCCG
                      ____________________________________________________________
consensus TTGCCAAAAGCTTTGAGCACTTTAGGATCCGTGTCATACAGCTTCAACCTGGTGGCCCCG
 
. : . : . : . : . : . :
JMSF052O01+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
JMFS102H05+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
JMFF012M17+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
JMFS034C03+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
JMSF034C05+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
JMSF030I20+ ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
                      ____________________________________________________________
consensus ACGGCTTTCACCAACGGCACCACATCCTCCGGCGAAGGCAGATTGTCAGCAACCTGGCCG
 
. : . : . : . : . : . :
JMSF052O01+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
JMFS102H05+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
JMFF012M17+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
JMFS034C03+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACG------------CATAGAAAAAG
JMSF034C05+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
JMSF030I20+ TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
                      ____________________________________________________________
consensus TAGTTGATCCCAATCGACGCCGCCAATCCCTGGTACGCTATCAATAAAACATAGAAAAAG
 
. : . : . : . : . : . :
JMSF052O01+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
JMFS102H05+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
JMFF012M17+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
JMFS034C03+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
JMSF034C05+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
JMSF030I20+ AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
                      ____________________________________________________________
consensus AATGGAATAGAAAAACGGAGACGAGAAGGGAACAAGGCTTCCCCCCTCCCCATTAATGGC
 
. : . : . : . : . : . :
JMSF052O01+ GTAGTGAGAGAGAAGATTGGAGTTAGCTGAGGTTCTGAATGGGGGAACT
JMFS102H05+ GTAGTGAGAGAGAAGATTGGAGTTAG
JMFF012M17+ GTAGTGAGAGAGAAGATTGGAGTTAGCTGAGGTTCTGAAT
JMFS034C03+ GTAGTGAGAGAGAAGATTGGAGTTAG
JMSF034C05+ GTAGTGAGAGAGAAGATTGGAGTTAGCTGAGGTTCTGAATGGGGGAACT
JMSF030I20+ GTAGTGAGAGAGAAGATTGGAGTTAGCTGAGGTTCTGAATGGGGGAACTACTGGAGATCC
                      ____________________________________________________________
consensus GTAGTGAGAGAGAAGATTGGAGTTAGCTGAGGTTCTGAATGGGGGAACTACTGGAGATCC