Previous Contig 006675:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011L20Sequence276006675 (4)gb:AJ630658_18127712e-11Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene650006675 (4)gb:AJ630658_18127714e-25Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene
JMSF030I15Sequence659006675 (4)gb:AJ630658_18127713e-26Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene642006675 (4)gb:AJ630658_18127713e-26Cicer arietinum mRNA for putative lipid transfer protein GPI-anchored (Ltp2 gene

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011L20+ AGAAAATGACGATGAGGCTACAAACAATCTTCTACTACTGTTTATTAGTAA
rJMSF030I15+ AAGAAAATGACGATGAGGCTACAAACAATCTTCTACTACTGTTTATTAGTAA
JMSF011L20- AGAAAATGACGATGAGGCTACAAACAATCTTCTACTACTGTTTATTAGTAA
JMSF030I15- GGAATTGAAGAAAATGACGATGAGGCTACAAACAATCTTCTACTACTGTTTATTAGTAA
                      ____________________________________________________________
consensus GGAATTGAAGAAAATGACGATGAGGCTACAAACAATCTTCTACTACTGTTTATTAGTAA
 
. : . : . : . : . : . :
rJMSF011L20+ TGTTGATTGTGAGCGGCGGTTTGGTAAAGGGGGCCGAGGACTTGCAGGACAGGTGCGGGA
rJMSF030I15+ TGTTGATTGTGAGCGGCGGTTTGGTAAAGGGAGCCGAGGACTTGCAGGACAGGTGCGGGA
JMSF011L20- TGTTGATTGTGAGCGGCGGTTTGGTAAAGGGGGCCGAGGACTTGCAGGACAGGTGCGGGA
JMSF030I15- TGTTGATTGTGAGCGGCGGTTTGGTAAAGGGAGCCGAGGACTTGCAGGACAGGTGCGGGA
                      ____________________________________________________________
consensus TGTTGATTGTGAGCGGCGGTTTGGTAAAGGGGGCCGAGGACTTGCAGGACAGGTGCGGGA
 
. : . : . : . : . : . :
rJMSF011L20+ AAGACATCCAGAAGGTGGTGGCGTGCCTGAGCTTCGCTACTGGGAAGGCGGCGACGCCAG
rJMSF030I15+ AAGACATCCAGAAGGTGGTGGCGTGCCTGAGCTTCGCTACTGGGAAGGCGGCGACGCCAG
JMSF011L20- AAGACATCCAGAAGGTGGTGGCGTGCCTGAGCTTCGCTACTGGGAAGGCGGCGACGCCAG
JMSF030I15- AAGACATCCAGAAGGTGGTGGCGTGCCTGAGCTTCGCTACTGGGAAGGCGGCGACGCCAG
                      ____________________________________________________________
consensus AAGACATCCAGAAGGTGGTGGCGTGCCTGAGCTTCGCTACTGGGAAGGCGGCGACGCCAG
 
. : . : . : . : . : . :
rJMSF011L20+ GGAAGGAGTGCTGCGAGTCGGCGTCGAGCATCGAGGCGAGTGAACGCCCGCTTTGCTTTT
rJMSF030I15+ GGAAGGAGTGCTGCGAGTCGGCGTCGAGCATCGAGGCGAGTGAACGCCCGCTTTGCTTTT
JMSF011L20- GGAAGGAGTGCTGCGAGTCGGCGTCGAGCATCGAGGCGAGTGAACGCCCGCTTTGCTTTT
JMSF030I15- GGAAGGAGTGCTGCGAGTCGGCGTCGAGCATCGAGGCGAGTGAACGCCCGCTTTGCTTTT
                      ____________________________________________________________
consensus GGAAGGAGTGCTGCGAGTCGGCGTCGAGCATCGAGGCGAGTGAACGCCCGCTTTGCTTTT
 
. : . : . : . : . : . :
rJMSF011L20+ GCTATATGATAGAGCAGGTGCACAATGGATCTAACACTCAGATACAGAGCTCCGGTATTC
rJMSF030I15+ GCTATATGATAGAGCAGGTGCACAATGGATCTAACACTCAGATACAGAGCTCCGGTATTC
JMSF011L20- GCTATATGATAGAGCAGGTGCACAATGGATCTAACACTCAGA
JMSF030I15- GCTATATGATAGAGCAGGTGCACAATGGATCTAACACTCAGATACAGAGCTCCGGTATTC
                      ____________________________________________________________
consensus GCTATATGATAGAGCAGGTGCACAATGGATCTAACACTCAGATACAGAGCTCCGGTATTC
 
. : . : . : . : . : . :
rJMSF011L20+ AGGAAGCTCGATTGCTTCAGCTCCCTTCTGCTTGCAAGATCAACGACGTCAACGTCACTA
rJMSF030I15+ AGGAAGCTCGATTGCTTCAGCTCCCTTCTGCTTGCAAGATCAACGACGTCAACGTCACTA
JMSF030I15- AGGAAGCTCGATTGCTTCAGCTCCCTTCTGCTTGCAAGATCAACGACGTCAACGTCACTA
                      ____________________________________________________________
consensus AGGAAGCTCGATTGCTTCAGCTCCCTTCTGCTTGCAAGATCAACGACGTCAACGTCACTA
 
. : . : . : . : . : . :
rJMSF011L20+ CCTGTCCGAAGCTGTTGAAACTTCCGGCAAACTCTCCCGACATCGCTTTCTTCACCAACA
rJMSF030I15+ CCTGTCCGAAGCTGTTGAAACTTCCGGCAAACTCTCCCGACATCGCTTTCTTCACCAACA
JMSF030I15- CCTGTCCGAAGCTGTTGAAACTTCCGGCAAACTCTCCCGACATCGCTTTCTTCACCAACA
                      ____________________________________________________________
consensus CCTGTCCGAAGCTGTTGAAACTTCCGGCAAACTCTCCCGACATCGCTTTCTTCACCAACA
 
. : . : . : . : . : . :
rJMSF011L20+ CTTCTGCTAATTCTGCTTCCACTACTCCCGGCGTCGGAGCAGGCCCTGCTCTCTCCAATG
rJMSF030I15+ CTTCTGCTAATTCTGCTTCCACTACTCCCGGCGTCGGAGCAGGCCCTGCTCCCTCCAATG
JMSF030I15- CTTCTGCTAATTCTGCTTCCACTACTCCCGGCGTCGGAGCAGGCCCTGCTCCCTCCAATG
                      ____________________________________________________________
consensus CTTCTGCTAATTCTGCTTCCACTACTCCCGGCGTCGGAGCAGGCCCTGCTCCCTCCAATG
 
. : . : . : . : . : . :
rJMSF011L20+ CCTTCAAGCATAATCCCCTGCAGCTTGCTGGACACTTACCGGTTGCGGTAGCCATCTTCT
rJMSF030I15+ CCTTCAAGCATAATCCCCTGCAGCTTGCTGGACACTTACCGGTTGCGGTAGCCATCTTCT
JMSF030I15- CCTTCAAGCATAATCCCCTGCAGCTTGCTGGACACTTACCGGTTGCGGTAGCCATCTTCT
                      ____________________________________________________________
consensus CCTTCAAGCATAATCCCCTGCAGCTTGCTGGACACTTACCGGTTGCGGTAGCCATCTTCT
 
. : . : . : . : . : . :
rJMSF011L20+ ATTTCACATTTTGGAAATTGTTTTAAATGTATGTAGTTACGATAAATATAATTTCTATGC
rJMSF030I15+ ATTTCACATTTTGGAAATTGTTTTAAATGTATGTAGTTACGATAAATATAATTTCTATGC
JMSF030I15- ATTTCACATTTTGGAAATTGTTTTAAATGTATGTAGTTACGATAAATATAATTTCTATGC
                      ____________________________________________________________
consensus ATTTCACATTTTGGAAATTGTTTTAAATGTATGTAGTTACGATAAATATAATTTCTATGC
 
. : . : . : . : . : . :
rJMSF011L20+ TGGCTTAGAACACCATACTTATATTTTTAAAATATTTACCTCTGGAATGTAATCTT
rJMSF030I15+ TGGCTTAGAACACCATACTTATATTTTTAAAATATTTACCTCT
JMSF030I15- TGGCTTAGAACACCATACTTATATTTTTAAAATATTTACCTCTGGAATGTAATCTTTATG
                      ____________________________________________________________
consensus TGGCTTAGAACACCATACTTATATTTTTAAAATATTTACCTCTGGAATGTAATCTTTATG