Previous Contig 006673:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030H21Sequence608006673 (2)sp|P21343|PFPB_SOLTU2e-76Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.645009480 (9)pir|B36094|B360948e-92diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF047A08Sequence661006673 (2)sp|P21343|PFPB_SOLTU4e-86Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.772009480 (9)pir|B36094|B36094e-107diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047A08+ CT
                      ____________________________________________________________
consensus CT
 
. : . : . : . : . : . :
JMSF047A08+ ACAAGGCCATCCAAATCAAGCTTCTTTACTGTTTCTTCAGCTTGTTTAAACTGCTCTGGA
JMSF030H21+ TCTGGA
                      ____________________________________________________________
consensus ACAAGGCCATCCAAATCAAGCTTCTTTACTGTTTCTTCAGCTTGTTTAAACTGCTCTGGA
 
. : . : . : . : . : . :
JMSF047A08+ GTCTCAATCTTGTCCCTTCCACTACAAATCATATCAAATCCACCCTGATTTCTATATGGG
JMSF030H21+ GTCTCAATCTTGTCCCTTCCACTACAAATCATATCAAATCCACCCTGATTTCTATATGGG
                      ____________________________________________________________
consensus GTCTCAATCTTGTCCCTTCCACTACAAATCATATCAAATCCACCCTGATTTCTATATGGG
 
. : . : . : . : . : . :
JMSF047A08+ TAAATATATTCTGGGGTCAGTACCACATACTTGCACTTCATGATCCCAGCTGGTCCGCCC
JMSF030H21+ TAAATATATTCTGGGGTCAGTACCACATACTTGCACTTCATGATCCCAGCTGGTCCGCCC
                      ____________________________________________________________
consensus TAAATATATTCTGGGGTCAGTACCACATACTTGCACTTCATGATCCCAGCTGGTCCGCCC
 
. : . : . : . : . : . :
JMSF047A08+ CTGAACCCATATAATGTGCTTCCTTTGCAATATTTCTGCAAGTAATCAAAAATTCCAGAG
JMSF030H21+ CTGAACCCATATAATGTGCTTCCTTTGCAATATTTCTGCAAGTAATCAAAAATTCCAGAG
                      ____________________________________________________________
consensus CTGAACCCATATAATGTGCTTCCTTTGCAATATTTCTGCAAGTAATCAAAAATTCCAGAG
 
. : . : . : . : . : . :
JMSF047A08+ ATAACATTATGTCCTCCAGGAGCTTGGCCTCCAGATAAAACCACCCCAATCTTCAAGCTC
JMSF030H21+ ATAACATTATGTCCTCCAGGAGCTTGGCCTCCAGATAAAACCACCCCAATCTTCAAGCTC
                      ____________________________________________________________
consensus ATAACATTATGTCCTCCAGGAGCTTGGCCTCCAGATAAAACCACCCCAATCTTCAAGCTC
 
. : . : . : . : . : . :
JMSF047A08+ TGGCCCATTGCAACGTCACCTGAGTCATCCGGTACCAATGCTGCTGATGGTTGTCCAAAT
JMSF030H21+ TGGCCCATTGCAACGTCACCTGAGTCATCCGGTACCAATGCTGCTGATGGTTGTCCAAAT
                      ____________________________________________________________
consensus TGGCCCATTGCAACGTCACCTGAGTCATCCGGTACCAATGCTGCTGATGGTTGTCCAAAT
 
. : . : . : . : . : . :
JMSF047A08+ AGGCAAGGAAACAGCTTTGCTATCTCCTCAGGGTGGCCGGCGGCAGAGCTCGCGGGGCCA
JMSF030H21+ AGGCAAGGAAACAGCTTTGCTATCTCCTCAGGGTGGCCGGCGGCAGAGCTCGCGGGGCCA
                      ____________________________________________________________
consensus AGGCAAGGAAACAGCTTTGCTATCTCCTCAGGGTGGCCGGCGGCAGAGCTCGCGGGGCCA
 
. : . : . : . : . : . :
JMSF047A08+ TCGACAACCTTGAAGGGCTTTTTGAGGACGGAAGGAAGAGGGAGCGGGTGATCGAGACGG
JMSF030H21+ TCGACAACCTTGAAGGGCTTTTTGAGGACGGAAGGAAGAGGGAGCGGGTGATCGAGACGG
                      ____________________________________________________________
consensus TCGACAACCTTGAAGGGCTTTTTGAGGACGGAAGGAAGAGGGAGCGGGTGATCGAGACGG
 
. : . : . : . : . : . :
JMSF047A08+ TTATTCTGAACTTCACTGTAAACGGAGGCGTAACG
JMSF030H21+ TTATTCTGAACTTCACTGTAAACGGAGGCGTAACGACTTGTGAAACTCTTCGCCGAGACA
                      ____________________________________________________________
consensus TTATTCTGAACTTCACTGTAAACGGAGGCGTAACGACTTGTGAAACTCTTCGCCGAGACA
 
. : . : . : . : . : . :
JMSF030H21+ GTACCGCCGTTGGTGAATAGGGAAGTTGCCGCCACCGCCATGGATTGATTTCGCCGAAAA
                      ____________________________________________________________
consensus GTACCGCCGTTGGTGAATAGGGAAGTTGCCGCCACCGCCATGGATTGATTTCGCCGAAAA
 
. : . : . : . : . : . :
JMSF030H21+ CAGAGAGAGGGAGAGAGAGAAGAGCTGAGTGATAGAGAGAAGTTAACTGCCGGAACTCAC
                      ____________________________________________________________
consensus CAGAGAGAGGGAGAGAGAGAAGAGCTGAGTGATAGAGAGAAGTTAACTGCCGGAACTCAC