Previous Contig 006667:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014I10Sequence619006667 (7)gb:AY094032_15755382e-50Arabidopsis thaliana At1g23740/F5O8_27 mRNA, complete cds.>gb:AF411799_1797263 A
JMSF030H01Sequence666006667 (7)gb:AY094032_15755383e-52Arabidopsis thaliana At1g23740/F5O8_27 mRNA, complete cds.>gb:AF411799_1797263 A760006667 (7)gb:AY094032_15755384e-41Arabidopsis thaliana At1g23740/F5O8_27 mRNA, complete cds.>gb:AF411799_1797263 A
JMSF038G13Sequence692006667 (7)gb:AY094032_15755387e-57Arabidopsis thaliana At1g23740/F5O8_27 mRNA, complete cds.>gb:AF411799_1797263 A885006667 (7)gb:AY085513_15705821e-77Arabidopsis thaliana clone 155143 mRNA, complete sequence.
JMSF038N08Sequence689006667 (7)gb:AY094032_15755382e-56Arabidopsis thaliana At1g23740/F5O8_27 mRNA, complete cds.>gb:AF411799_1797263 A928006667 (7)gb:AY085513_15705821e-78Arabidopsis thaliana clone 155143 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030H01- ATT
                      ____________________________________________________________
consensus ATT
 
. : . : . : . : . : . :
rJMSF030H01- TTCTTAACTTACACTACAAATGCAATCTTTGAAAACAAGTAATAATGATGATATATATAA
                      ____________________________________________________________
consensus TTCTTAACTTACACTACAAATGCAATCTTTGAAAACAAGTAATAATGATGATATATATAA
 
. : . : . : . : . : . :
rJMSF030H01- AACCACCATAGACATATGGAGGTCATGGATGGTAACGGGAAGTTTTCAAAAATTTCTGAT
                      ____________________________________________________________
consensus AACCACCATAGACATATGGAGGTCATGGATGGTAACGGGAAGTTTTCAAAAATTTCTGAT
 
. : . : . : . : . : . :
rJMSF030H01- TAACAACCTCTCAGGAAGAATACAATAAACATATTAGAAAAAAGTATCATATAGGCCATC
rJMSF038G13- ATAAACATATTAGAAAAAAGTATCATATAGGCCATC
rJMSF038N08- ACCTCTCAGGAAGAATACAATAAACATATTAGAAAAAAGTATCATATAGGCCATC
                      ____________________________________________________________
consensus TAACAACCTCTCAGGAAGAATACAATAAACATATTAGAAAAAAGTATCATATAGGCCATC
 
. : . : . : . : . : . :
rJMSF030H01- AAACTTTAGATTGTGGGTACGAGTAGAGGCCATCAAACTTTAGATTGTGGGTACGAGTAG
rJMSF038G13- AAACTTTAGATTGTGGGTACGAGTAGAGGCCATCAAACTTTAGATTGTGGGTACGAGTAG
rJMSF038N08- AAACTTTAGATTGTGGGTACGAGTAGAGGCCATCAAACTTTAGATTGTGGGTACGAGTAG
                      ____________________________________________________________
consensus AAACTTTAGATTGTGGGTACGAGTAGAGGCCATCAAACTTTAGATTGTGGGTACGAGTAG
 
. : . : . : . : . : . :
rJMSF030H01- AGGCATGGGTGTGTCTATATCCGTGCCTACCAGGCAAAGCTAGCGTAGAACAATGAGCAC
rJMSF038G13- AGGCATGGGTGTGTCTATATCCGTGCCTACCAGGCAAAGCTAGCGTAGAACAATGAGCAC
rJMSF038N08- AGGCATGGGTGTGTCTATATCCGTGCCTACCAGGCAAAGCTAGCGTAGAACAATGAGCAC
                      ____________________________________________________________
consensus AGGCATGGGTGTGTCTATATCCGTGCCTACCAGGCAAAGCTAGCGTAGAACAATGAGCAC
 
. : . : . : . : . : . :
rJMSF030H01- AATATAAACTGAGTCCTCTACACAGCAAAACTTTTTCTCCCATCCACTTAGTATATCTTT
rJMSF038G13- AATATAAACTGAGTCCTCTACACAGCAAAACTTTTTCTCCCATCCACTTAGTATATCTTT
rJMSF038N08- AATATAAACTGAGTCCTCTACACAGCAAAACTTTTTCTCCCATCCACTTAGTATATCTTT
                      ____________________________________________________________
consensus AATATAAACTGAGTCCTCTACACAGCAAAACTTTTTCTCCCATCCACTTAGTATATCTTT
 
. : . : . : . : . : . :
rJMSF030H01- AATTTGTTAAGAACAATAAGTGTAAGTAATAGCTCTCAGGGAATAGGATGTATAACAACT
rJMSF038G13- AATTTGTTAAGAACAATAAGTGTAAGTAATAGCTCTCAGGGAATAGGATGTATAACAACT
rJMSF038N08- AATTTGTTAAGAACAATAAGTGTAAGTAATAGCTCTCAGGGAATAGGATGTATAACAACT
                      ____________________________________________________________
consensus AATTTGTTAAGAACAATAAGTGTAAGTAATAGCTCTCAGGGAATAGGATGTATAACAACT
 
. : . : . : . : . : . :
rJMSF030H01- TTCCCAGTGGCACGGCCAGTTTCAAGGTAAGAAAATGCTTCTGCAACCTTGTCAAATGGA
rJMSF038G13- TTCCCAGTGGCACGGCCAGTTTCAAGGTAAGAAAATGCTTCTGCAACCTTGTCAAATGGA
rJMSF038N08- TTCCCAGTGGCACGGCCAGTTTCAAGGTAAGAAAATGCTTCTGCAACCTTGTCAAATGGA
                      ____________________________________________________________
consensus TTCCCAGTGGCACGGCCAGTTTCAAGGTAAGAAAATGCTTCTGCAACCTTGTCAAATGGA
 
. : . : . : . : . : . :
rJMSF030H01- AATGGACCCTTGGGGTCTATCACTGGCTTCACCTTCCCACTTTCTAGGAAAGGGTTGAGT
rJMSF038G13- AATGGACCCTTGGGGTCTATCACTGGCTTCACCTTCCCACTTTCTAGGAAAGGGTTGAGT
rJMSF038N08- AATGGACCCTTGGGGTCTATCACTGGCTTCACCTTCCCACTTTCTAGGAAAGGGTTGAGT
                      ____________________________________________________________
consensus AATGGACCCTTGGGGTCTATCACTGGCTTCACCTTCCCACTTTCTAGGAAAGGGTTGAGT
 
. : . : . : . : . : . :
rJMSF030H01- TTCTTCAACACTTCTCCGTTGGATGTGACTACGAACCTGAAACCGGGGGGCGTGACTGCA
rJMSF038G13- TTCTTCAACACTTCTCCGTTGGATGTGACTACGAACCTGAAACCGGGGGGCGTGACTGCA
rJMSF038N08- TTCTTCAACACTTCTCCGTTGGATGTGACTACGAACCTGAAACCGGGGGGCGTGACTGCA
                      ____________________________________________________________
consensus TTCTTCAACACTTCTCCGTTGGATGTGACTACGAACCTGAAACCGGGGGGCGTGACTGCA
 
. : . : . : . : . : . :
rJMSF030H01- CCGGTTAGCACCACCACGCTCCCGCCTTCCTTCACCACCTTAACTGCCTTCTCTCCCTGC
rJMSF038G13- CCGGTTAGCACCACCACGCTCCCGCCTTCCTTCACCACCTTAACTGCCTTCTCTCCCTGC
rJMSF038N08- CCGGTTAGCACCACCACGCTCCCGCCTTCCTTCACCACCTTAACTGCCTTCTCTCCCTGC
                      ____________________________________________________________
consensus CCGGTTAGCACCACCACGCTCCCGCCTTCCTTCACCACCTTAACTGCCTTCTCTCCCTGC
 
. : . : . : . : . : . :
rJMSF030H01- CCGACTGTATCATAGACCACATCAAACTTGTCTGGTATGTCTTCAAAGTTGTCCTTTGTG
rJMSF038G13- CCGACTGTATCATAGACCACATCAAACTTGTCTGGTATGTCTTCAAAGTTGTCCTTTGTG
rJMSF038N08- CCGACTGTATCATAGACCACATCAAACTTGTCTGGTATGTCTTCAAAGTTGTCCTTTGTG
                      ____________________________________________________________
consensus CCGACTGTATCATAGACCACATCAAACTTGTCTGGTATGTCTTCAAAGTTGTCCTTTGTG
 
. : . : . : . : . : . :
rJMSF030H01- TAGTCNATAGCCNAATCAGCGCCTAAGCTTTTCA
rJMSF038G13- TAGTCAATAGCCAAATCAGCGCCTAAGCTTTTCAACAACTCCAACTTGCCAGTGCTGGAT
rJMSF038N08- TAGTCAATAGCCAAATCAGCGCCTAAGCTTTTCAACAACTCCAACTTGCCAGTGCTGGAT
                      ____________________________________________________________
consensus TAGTCAATAGCCAAATCAGCGCCTAAGCTTTTCAACAACTCCAACTTGCCAGTGCTGGAT
 
. : . : . : . : . : . :
rJMSF038G13- GTAGCTGCAACTTTTGAAGCACCAAATACATGCTTTGCGAGCTGAATGACGAGAGATCCA
rJMSF038N08- GTAGCTGCAACTTTTGAAGCACCAAATACATGCTTTGCGAGCTGAATGACGAGAGATCCA
                      ____________________________________________________________
consensus GTAGCTGCAACTTTTGAAGCACCAAATACATGCTTTGCGAGCTGAATGACGAGAGATCCA
 
. : . : . : . : . : . :
rJMSF038G13- ACTCCTCCTGCACCACCCAAGACGAGGATGGATTTTCCAGAAGAAAATTCTGCCCTTTCA
rJMSF038N08- ACTCCTCCTGCACCACCCAAGACGAGGATGGATTTTCCAGAAGAAAATTCTGCCCTTTCA
                      ____________________________________________________________
consensus ACTCCTCCTGCACCACCCAAGACGAGGATGGATTTTCCAGAAGAAAATTCTGCCCTTTCA
 
. : . : . : . : . : . :
rJMSF038G13- AGACCTTCGTAGGCGGTCTCTATGGCAAGAGGAAGAGCAGCAGCCTGTTCAAAACTAAGA
rJMSF038N08- AGACCTTCGTAGGCGGTCTCTATGGCAAGAGGAAGAGCAGCAGCCTGTTCAAAACTAAGA
JMSF038N08+ AGGAAGAGCAGCAGCCTGTTCAAAACTAAGA
JMSF038G13+ AGGAAGAGCAGCAGCCTGTTCAAAACTAAGA
JMSF030H01+ ACTAAGA
                      ____________________________________________________________
consensus AGACCTTCGTAGGCGGTCTCTATGGCAAGAGGAAGAGCAGCAGCCTGTTCAAAACTAAGA
 
. : . : . : . : . : . :
rJMSF038G13- TTCTTTGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
rJMSF038N08- TTCTTTGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
JMSF038N08+ TTCTTNGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
JMFN014I10+ TTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
JMSF038G13+ TTCTTNGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
JMSF030H01+ TTCTTNGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
                      ____________________________________________________________
consensus TTCTTTGGCTTCAAAGCCAGCAGTTTCTCCTCAACTGCAGTGTACTGACCTAATGAACCA
 
. : . : . : . : . : . :
rJMSF038G13- AACTGCTTG
rJMSF038N08- AACTGCTTGGGGTCCTTCCAATGCTTTC
JMSF038N08+ AACTGCTT-GGGTCCTTCCAATGCTTTCTCATTTATGTTTCCATAAACTTCGTCACCTAG
JMFN014I10+ AACTGCTT-GGGTCCTTCCAATGCTTTCTCATTTATGTTTCCATAAACTTCGTCACCTAG
JMSF038G13+ AACTGCTT-GGGTCCTTCCAATGCTTTCTCATTTATGTTTCCATAAACTTCGTCACCTAG
JMSF030H01+ AACTGCTT-GGGTCCTTCCAATGCTTTCTCATTTATGTTTCCATAAACTTCGTCACCTAG
                      ____________________________________________________________
consensus AACTGCTT-GGGTCCTTCCAATGCTTTCTCATTTATGTTTCCATAAACTTCGTCACCTAG
 
. : . : . : . : . : . :
JMSF038N08+ TCTTAGGCCTTTTACTTGACTACCAACTTGGATTACTACACCAGCAACATCATAGCCCGG
JMFN014I10+ TCTTAGGCCTTTTACTTGACTACCAACTTGGATTACTACACCAGCAACATCATAGCCCGG
JMSF038G13+ TCTTAGGCCTTTTACTTGACTACCAACTTGGATTACTACACCAGCAACATCATAGCCCGG
JMSF030H01+ TCTTAGGCCTTTTACTTGACTACCAACTTGGATTACTACACCAGCAACATCATAGCCCGG
                      ____________________________________________________________
consensus TCTTAGGCCTTTTACTTGACTACCAACTTGGATTACTACACCAGCAACATCATAGCCCGG
 
. : . : . : . : . : . :
JMSF038N08+ TACAGTAGGAAGAGGCGAATCAGTGGCCTTGAACTTGCCCTGTCTGCGCTTGAAATCAAC
JMFN014I10+ TACAGTAGGAAGAGGCGAATCAGTGGCCTTGAACTTGCCCTGTCTGCGCTTGAAATCAAC
JMSF038G13+ TACAGTAGGAAGAGGCGAATCAGTGGCCTTGAACTTGCCCTGTCTGCGCTTGAAATCAAC
JMSF030H01+ TACAGTAGGAAGAGGCGAATCAGTGGCCTTGAACTTGCCCTGTCTGCGCTTGAAATCAAC
                      ____________________________________________________________
consensus TACAGTAGGAAGAGGCGAATCAGTGGCCTTGAACTTGCCCTGTCTGCGCTTGAAATCAAC
 
. : . : . : . : . : . :
JMSF038N08+ AGGATTGAGAGCCGCAGCAGCAACTTTGATCAACACCTGATCATCTTGTATCTGAGGCAC
JMFN014I10+ AGGATTGAGAGCCGCAGCAGCAACTTTGATCAACACCTGATCATCTTGTATCTGAGGCAC
JMSF038G13+ AGGATTGAGAGCCGCAGCAGCAACTTTGATCAACACCTGATCATCTTGTATCTGAGGCAC
JMSF030H01+ AGGATTGAGAGCCGCAGCAGCAACTTTGATCAACACCTGACCATCTTGTATCTGAGGCAC
                      ____________________________________________________________
consensus AGGATTGAGAGCCGCAGCAGCAACTTTGATCAACACCTGATCATCTTGTATCTGAGGCAC
 
. : . : . : . : . : . :
JMSF038N08+ TGCAACACTGGGTTCCACCTTCAAAACATCAACACCTCCATACTCTCCATAAGTCCAAGC
JMFN014I10+ TGCAATACTGGGTTCCACCTTCAAAACATCAACACCTCCATACTCTCCATAAGTCCAAGC
JMSF038G13+ TGCAACACTGGGTTCCACCTTCAAAACATCAACACCTCCATACTCTCCATAAGTCCAAGC
JMSF030H01+ TGCAACACTGGGTTCCACCTTCAAAACATCAACACCTCCATACTCTCCATAAGTCCAAGC
                      ____________________________________________________________
consensus TGCAACACTGGGTTCCACCTTCAAAACATCAACACCTCCATACTCTCCATAAGTCCAAGC
 
. : . : . : . : . : . :
JMSF038N08+ ATTCATCTCAAAGGGAAAGAATAATGTGGCTGTAGAGGCCTCAGCTGATGCAGCCTGGGA
JMFN014I10+ ATTCATCTCAAAGGGAAAGAATAATGTGGCTGTAGAGGCCTCAGCTGATGCAGCCTGGGA
JMSF038G13+ ATTCATCTCAAAGGGAAAGAATAATGTGGCTGTAGAGGCCTCAGCTGATGCAGCCTGGGA
JMSF030H01+ ATTCATCTCAAAGGGAAAGAATAATGTGGCTGTAGAGGCCTCAGCTGATGCAGCCTGGGA
                      ____________________________________________________________
consensus ATTCATCTCAAAGGGAAAGAATAATGTGGCTGTAGAGGCCTCAGCTGATGCAGCCTGGGA
 
. : . : . : . : . : . :
JMSF038N08+ ACTCGCCAAGACTCTGAAAGATAACTGAGTCCTCTGAACCCAAGAATCTGCAGCTTTTCT
JMFN014I10+ ACTCGCCAAGACTCTGAAAGATAACTGAGTCCTCTGAACCCAAGAATCTGCAGCTTTTCT
JMSF038G13+ ACTCGCCAAGACTCTGAAAGATAACTGAGTCCTCTGAACCCAAGAATCTGCAGCTTTTCT
JMSF030H01+ ACTCGCCAAGACTCTGAAAGATAACTGAGTCCTCTGAACCCAAGAATCTGCAGCTTTTCT
                      ____________________________________________________________
consensus ACTCGCCAAGACTCTGAAAGATAACTGAGTCCTCTGAACCCAAGAATCTGCAGCTTTTCT
 
. : . : . : . : . : . :
JMSF038N08+ GCTCCTGCAGTGAAGTTTGAACACAGCAGAAAGACAGGATGGAGAGTGGGGAGGGTGAAG
JMFN014I10+ GCTCCTGCAGTGAAGTTTGAACACAGCAGAAAGACAGGATGGAGAGTGGGGAGGGTGAAG
JMSF038G13+ GCTCCTGCAGTGAAGTTTGAACACAGCAGAAAGACAGGATGGAGAGTGGGGAGGGTGAAG
JMSF030H01+ GCTCCTGCAGTGAAGTTTGAACACAGCAGAAAGACAGGATGGAGAGTGGGGAGGGTGAAG
                      ____________________________________________________________
consensus GCTCCTGCAGTGAAGTTTGAACACAGCAGAAAGACAGGATGGAGAGTGGGGAGGGTGAAG
 
. : . : . : . : . : . :
JMSF038N08+ GGTTCTTCTCACTGGAAGAGTTGTGGAGGAGAGCAGTGCTTCCATGATTTTTTACTTTGC
JMFN014I10+ GGTTCTTCTCACTGGAAGAGTTGTGGAGGAGAGCAGTGCTTCCATGATTTTTTACTTTGC
JMSF038G13+ GGTTCTTCTCACTGGAAGAGTTGTGGAGGAGAGCAGTGCTTCCATGATTTTTTACTTTGC
JMSF030H01+ GGTTCTTCTCACTGGAAGAGTTGTGGAGGAGAGCAGTGCTTCCATGATTTTTTACTTTGC
                      ____________________________________________________________
consensus GGTTCTTCTCACTGGAAGAGTTGTGGAGGAGAGCAGTGCTTCCATGATTTTTTACTTTGC
 
. : . : . : . : . : . :
JMSF038N08+ TTTTCTGCTTCTCTTCTCAGCTCTTCTGTGTTATGGCAGACTGTGATTGCTTGTC
JMFN014I10+ TTTTCTGCTTCTCTTCTCAGCTCTTCTGT
JMSF038G13+ TTTTCTGCTTCTCTTCTCAGCTCTTCTGTGTTATGGCAGACTGTGATTGCTTGTC
JMSF030H01+ TTTTCTGCTTCTCTTCTCAGCTCTTCTGTGTTATGGCAGACTGTGATTGCTTGTCCTCAA
                      ____________________________________________________________
consensus TTTTCTGCTTCTCTTCTCAGCTCTTCTGTGTTATGGCAGACTGTGATTGCTTGTCCTCAA