Previous Contig 006666:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030G24Sequence379006666 (2)334006666 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030G24+ GATCATTCCCATGGCTGTC
JMSF030G24- GATCATTCCCATGGCTGTC
                      ____________________________________________________________
consensus GATCATTCCCATGGCTGTC
 
. : . : . : . : . : . :
rJMSF030G24+ TACACTCTTGTAGAGATTCAACTCTCTACAAACACAGCCCCCAAACCCTCCCCTTCCCCA
JMSF030G24- TACACTCTTGTAGAGATTCAACTCTCTACAAACACAGCCCCCAAACCCTCCCCTTCCCCA
                      ____________________________________________________________
consensus TACACTCTTGTAGAGATTCAACTCTCTACAAACACAGCCCCCAAACCCTCCCCTTCCCCA
 
. : . : . : . : . : . :
rJMSF030G24+ CCCCCTCCCAAAAACCATTTTTGTTTCTACATAATAACATGGATTCTTGCCAGATTTGCA
JMSF030G24- CCCCCTCCCAAAAACCATTTTTGTTTCTACATAATAACATGGATTCTTGCCAGATTTGCA
                      ____________________________________________________________
consensus CCCCCTCCCAAAAACCATTTTTGTTTCTACATAATAACATGGATTCTTGCCAGATTTGCA
 
. : . : . : . : . : . :
rJMSF030G24+ TAGATCCATCTTCCTCCCAGACGTCGCTTTCCTTGAACTTGTTCTAATTCTCATGAAGAC
JMSF030G24- TAGATCCATCTTCCTCCCAGACGTCGCTTTCCTTGAACTTGTTCTAATTCTCATGAAGAC
                      ____________________________________________________________
consensus TAGATCCATCTTCCTCCCAGACGTCGCTTTCCTTGAACTTGTTCTAATTCTCATGAAGAC
 
. : . : . : . : . : . :
rJMSF030G24+ AGCGACACTACATACACAACATCAAAGTAAAGATTTGTCATTCCAGGATTTTGACTAGTC
JMSF030G24- AGCGACACTACATACACAACATCAAAGTAAAGATTTGTCATTCCAGGATTTTGACTAGTC
                      ____________________________________________________________
consensus AGCGACACTACATACACAACATCAAAGTAAAGATTTGTCATTCCAGGATTTTGACTAGTC
 
. : . : . : . : . : . :
rJMSF030G24+ AGTGAGGGCGATAAAGGCCTTGCGTACAGGTGGTCCGAATTGAACCGGATCTTAGGCTGG
JMSF030G24- AGTGAGGGCGATAAAGGCCTTGCGTACAGGTGGTCCGAATTGAACCGGATCTTAGGCTGG
                      ____________________________________________________________
consensus AGTGAGGGCGATAAAGGCCTTGCGTACAGGTGGTCCGAATTGAACCGGATCTTAGGCTGG
 
. : . : . : . : . : . :
rJMSF030G24+ GCTTATAGGGT
JMSF030G24- GCTTATAGGGTTAAGGTTGTAGTCTGAGATAATTGGGAAATTTATATTCCAAAAAAAAAA
                      ____________________________________________________________
consensus GCTTATAGGGTTAAGGTTGTAGTCTGAGATAATTGGGAAATTTATATTCCAAAAAAAAAA