Previous Contig 006664:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D10Sequence551006664 (11)gb:AY054666_15633207e-29Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D771011799 (12)gb:AY056242_15635634e-52Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMFF019M22Sequence584006664 (11)gb:AY054666_15633202e-36Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D698011799 (12)gb:AY056242_15635631e-58Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMFF033J17Sequence512006664 (11)gb:AY054666_15633201e-23Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D750011799 (12)gb:AY056242_15635637e-53Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMFF039M12Sequence506006664 (11)gb:AY054666_15633201e-23Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D701011799 (12)gb:AY056242_15635632e-63Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMFF049F01Sequence628006664 (11)gb:AY054666_15633204e-44Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D561011799 (12)gb:AY056242_15635638e-38Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF008J23Sequence277006664 (11)751011799 (12)gb:AY054666_15633204e-78Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D
JMSF014M20Sequence485006664 (11)gb:AY054666_15633207e-22Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D787011799 (12)gb:AY056242_15635631e-46Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF018B19Sequence260006664 (11)745011799 (12)gb:AY056242_15635635e-83Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF030G12Sequence661006664 (11)gb:AY054666_15633206e-45Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D750011799 (12)gb:AY056242_15635631e-49Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10
JMSF046G13Sequence754006664 (11)gb:AY054666_15633207e-61Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D743011799 (12)gb:AY054666_15633201e-62Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D
JMSF050M08Sequence581006664 (11)gb:AY054666_15633202e-38Arabidopsis thaliana endomembrane protein EMP70 precusor isolog (At1g10950; T19D773011799 (12)gb:AY056242_15635631e-73Arabidopsis thaliana putative endomembrane protein EMP70 precusor isolog (At1g10

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046G13+ ACCCATTTCCACTGAGTATGTCATGTCCAGTATTCTACCTTCCTCAAGTGGTTTAGGGCT
                      ____________________________________________________________
consensus ACCCATTTCCACTGAGTATGTCATGTCCAGTATTCTACCTTCCTCAAGTGGTTTAGGGCT
 
. : . : . : . : . : . :
JMSF046G13+ TTCTTGAGAGAGGTTAACATGAATGATCTGATTCCCATTGTACTGGACCAGAATATTCTT
                      ____________________________________________________________
consensus TTCTTGAGAGAGGTTAACATGAATGATCTGATTCCCATTGTACTGGACCAGAATATTCTT
 
. : . : . : . : . : . :
JMSF046G13+ GTGGGTATGTAGGACATGCTTCGTATCCCGATTTCTATCAGTGACCACTTCCCCCACAAA
JMFF049F01+ GGTATGTAGGACATGCTTCGTATCCCGATTTCTATCAGTGACCACTTCCCCCACAAA
JMSF030G12+ GGTATGTAGGACATGCTTCGTATCCCGATTTCTATCAGTGACCACTTCCCCCACAAA
                      ____________________________________________________________
consensus GTGGGTATGTAGGACATGCTTCGTATCCCGATTTCTATCAGTGACCACTTCCCCCACAAA
 
. : . : . : . : . : . :
JMSF046G13+ ACCCCACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
JMFF049F01+ ACCCCACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
JMFF019M22+ ACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
JMSF050M08+ ACCCCACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
JMFF006D10+ ATACGAATTATCAATTGCATC
JMSF030G12+ ACCCCACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
                      ____________________________________________________________
consensus ACCCCACAGAGGTAAATCATCCATGAAAAACTCAAACCAATACGAATTATCAATTGCATC
 
. : . : . : . : . : . :
JMSF046G13+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMFF049F01+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMFF019M22+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMSF050M08+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMFF033J17+ TATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMFF039M12+ CCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMSF014M20+ AGTTCACAAATAGAACTCTCATCTAC
JMFF006D10+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
JMSF030G12+ CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
                      ____________________________________________________________
consensus CTTAAACTGCCTAACCTTATATCCCTCCAATTCAAGTTCACAAATAGAACTCTTATCTAC
 
. : . : . : . : . : . :
JMSF046G13+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMFF049F01+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMFF019M22+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMSF050M08+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMFF033J17+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMFF039M12+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMSF014M20+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMFF006D10+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
JMSF030G12+ ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
                      ____________________________________________________________
consensus ATTTTTCTTAAATTTTATGTCAATTTGACTGTCAATAAGCTCATTCCCCCCAAGAACCTC
 
. : . : . : . : . : . :
JMSF046G13+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMFF049F01+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMFF019M22+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMSF050M08+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMFF033J17+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMFF039M12+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMSF014M20+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMFF006D10+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
JMSF030G12+ GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
                      ____________________________________________________________
consensus GCCAAGGCCACCCCATTTGTGTGAAGCCTTCCCAGAAGGGCGGCAAAATGGAAGGGTATA
 
. : . : . : . : . : . :
JMSF046G13+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMFF049F01+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMFF019M22+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMSF050M08+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMFF033J17+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMFF039M12+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMSF014M20+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMFF006D10+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
JMSF030G12+ ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
                      ____________________________________________________________
consensus ATAGTTGTAGGTCTCTTGCGGATTATTATATGGTCCAACCTTGTTTACCCATAAAGTAAC
 
. : . : . : . : . : . :
JMSF046G13+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMFF049F01+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMFF019M22+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMSF050M08+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMFF033J17+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMFF039M12+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMSF014M20+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMSF008J23+ ATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMFF006D10+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMSF018B19+ GGGTTGACGAGGAAGAGGGCGGAGAGAAG
JMSF030G12+ AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
                      ____________________________________________________________
consensus AGGGTCACCATCTTGGTACTTGGCGCAGATCGGGTTGACGAGGAAGAGGGCGGAGAGAAG
 
. : . : . : . : . : . :
JMSF046G13+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMFF049F01+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMFF019M22+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMSF050M08+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMFF033J17+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMFF039M12+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMSF014M20+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMSF008J23+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMFF006D10+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMSF018B19+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
JMSF030G12+ GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
                      ____________________________________________________________
consensus GAGAATGGAGAGCGATCGGAGAGAAGCAAACATGGCCTCTGCTATGGAGGAGGATAAATG
 
. : . : . : . : . : . :
JMSF046G13+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMFF049F01+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMFF019M22+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMSF050M08+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMFF033J17+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMFF039M12+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMSF014M20+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMSF008J23+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMFF006D10+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMSF018B19+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
JMSF030G12+ CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
                      ____________________________________________________________
consensus CGGGTTGGATCTGAATAGCCGTGAAGGGTAGGATTGATTGGCGATGAGAGGGGAAAGATA
 
. : . : . : . : . : . :
JMSF046G13+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMFF049F01+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMFF019M22+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMSF050M08+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMFF033J17+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMFF039M12+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMSF014M20+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMSF008J23+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMFF006D10+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMSF018B19+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
JMSF030G12+ TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
                      ____________________________________________________________
consensus TGATGAGTTTTGCGTTGTTGTTTGGAAGTGAGAATGGGAAGCGGAGGTCGTCTCTTCTCT
 
. : . : . : . : . : . :
JMSF046G13+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTAC
JMFF049F01+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCT
JMFF019M22+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAA
JMSF050M08+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTC
JMFF033J17+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAA
JMFF039M12+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGA
JMSF014M20+ TCTGTTTCTCTTTCTCTTCTCCGTTCTCTCTACTCCTT
JMSF008J23+ TCTGTT--TCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCT
JMFF006D10+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAA
JMSF018B19+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAA
JMSF030G12+ TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAACAGAGAGATCC
                      ____________________________________________________________
consensus TCTGTTTCTCTTTCTCTTCTCTGTTCTCTCTACTCCTTCTGGATCTGAACAGAGAGATCC