Previous Contig 006660:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D19Sequence397006660 (5)gb:AF280812_17828977e-21Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.642008536 (4)pir|T50833|T508337e-50nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF021K09Sequence427006660 (5)gb:AF280812_17828972e-26Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.661008536 (4)pir|T50833|T508336e-64nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF024B22Sequence490006660 (5)gb:AY835406_16303441e-47Hordeum vulgare Hs1 (Hs1) gene, complete cds.>gb:AF307333_1784660 Hordeum vulgar797008536 (4)pir|T50833|T508336e-67nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF027F18Sequence493006660 (5)gb:AF280812_17828971e-34Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.734008536 (4)pir|T50833|T508337e-75nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMSF030F17Sequence635006660 (5)gb:AF280812_17828972e-38Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.671008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF024B22+ CAGGGAGTGAAGCTCCGACGGCTTCAC
                      ____________________________________________________________
consensus CAGGGAGTGAAGCTCCGACGGCTTCAC
 
. : . : . : . : . : . :
JMFF024B22+ GATCGCGTCGTAGTCGAGGCTCGGTTTTCCGGTGAGGTTCGGTTCGCCTAATCCAACGGT
                      ____________________________________________________________
consensus GATCGCGTCGTAGTCGAGGCTCGGTTTTCCGGTGAGGTTCGGTTCGCCTAATCCAACGGT
 
. : . : . : . : . : . :
JMFF024B22+ GTACGAACACCGCCGCATCTCGCTTTCGATGGCGTAGAGAATCTTCTGAGCTATGTCCTC
                      ____________________________________________________________
consensus GTACGAACACCGCCGCATCTCGCTTTCGATGGCGTAGAGAATCTTCTGAGCTATGTCCTC
 
. : . : . : . : . : . :
JMFF024B22+ CGATTTGCGCCACGTCATCAGCCGAGGCAGCAAGCTAGCTTCGCTCGTGTGGCTCACAAC
JMSF030F17+ GGCAGCAAGCTAGCTTCGCTCGTGTGGCTCACAAC
                      ____________________________________________________________
consensus CGATTTGCGCCACGTCATCAGCCGAGGCAGCAAGCTAGCTTCGCTCGTGTGGCTCACAAC
 
. : . : . : . : . : . :
JMFF024B22+ CGTCGTTTCGCCGGAGAGCTTCCACACCTCAGCCGAGCTGTTCTCACGTGACAACACCAC
JMSF030F17+ CGTCGTTTCGCCGGAGAGCTTCCACACCTCAGCCGAGCTGTTCTCACGTGACAACACCAC
                      ____________________________________________________________
consensus CGTCGTTTCGCCGGAGAGCTTCCACACCTCAGCCGAGCTGTTCTCACGTGACAACACCAC
 
. : . : . : . : . : . :
JMFF024B22+ GTCCGACGACGTCAGATCGACAATCGGAGCCGCGCCACGCGTCTCTCCATCATCCTCACA
JMFF027F18+ CTCCATCATCCTCACA
JMSF030F17+ GTCCGACGACGTCAGATCGACAATCGGAGCCGCGCCACGCGTCTCTCCATCATCCTCACA
                      ____________________________________________________________
consensus GTCCGACGACGTCAGATCGACAATCGGAGCCGCGCCACGCGTCTCTCCATCATCCTCACA
 
. : . : . : . : . : . :
JMFF024B22+ CAACATAGCAATAATCTCAACCTGACTCCGAGCAAGCGACTCCAACCGCCGCTTCCACTC
JMFF027F18+ CAACATAGCAATAATCTCAACCTGACTCCGAGCAAGCGACTCCAACCGCCGCTTCCACTC
JMFF021K09+ GCTTCCACTC
JMSF030F17+ CAACATAGCAATAATCTCAACCTGACTCCGAGCAAGCGACTCCAACCGCCGCTTCCACTC
                      ____________________________________________________________
consensus CAACATAGCAATAATCTCAACCTGACTCCGAGCAAGCGACTCCAACCGCCGCTTCCACTC
 
. : . : . : . : . : . :
JMFF024B22+ CCGCCGGTTCGCGTACGGTCTAGGATCCGACAACACCA---GAACGAACCGGAAAGTTAT
JMFF027F18+ CCGCCGGTTCGCGTACGGTCTAGGATCCGACAACACCACAGAAACGAACCGGAAAGTTAT
JMFF021K09+ CCGCCGGTTCGCGTACGGTCTAGGATCCGACAACACCACAGAAACGAACCGGAAAGTTAT
JMFF008D19+ TAGGATCCGACAACACCACAGAAACGAACCGGAAAGTTAT
JMSF030F17+ CCGCCGGTTCGCGTACGGTCTAGGATCCGACAACACCACAGAAACGAACCGGAAAGTTAT
                      ____________________________________________________________
consensus CCGCCGGTTCGCGTACGGTCTAGGATCCGACAACACCACAGAAACGAACCGGAAAGTTAT
 
. : . : . : . : . : . :
JMFF024B22+ CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCAC
JMFF027F18+ CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCACCCCGGAAACTCATC
JMFF021K09+ CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCACCCCGGAAACTCATC
JMFF008D19+ CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCACCCCGGAAACTCATC
JMSF030F17+ CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCACCCCGGAAACTCATC
                      ____________________________________________________________
consensus CTCCAACCCTTGCAGAGCCGGCGTGAGCAGCGCCTCGTTCTTCCACCCCGGAAACTCATC
 
. : . : . : . : . : . :
JMFF027F18+ ACAACTCCACAGCTTCCTCAGCTCCGGCAGCCTCAAGTAGTACTCATAAGCGGAACAAGC
JMFF021K09+ ACAACTCCACAGCTTCCTCAGCTCCGGCAGCCTCAAGTAGTACTCATAAGCGGAACAAGC
JMFF008D19+ ACAACTCCACAGCTTCCTCAGCTCCGGCAGCCTCAAGTAGTACTCATAAGCGGAACAAGC
JMSF030F17+ ACAACTCCACAGCTTCCTCAGCTCCGGCAGCCTCAAGTAGTACTCATAAGCGGAACAAGC
                      ____________________________________________________________
consensus ACAACTCCACAGCTTCCTCAGCTCCGGCAGCCTCAAGTAGTACTCATAAGCGGAACAAGC
 
. : . : . : . : . : . :
JMFF027F18+ CGAGTCACTCGCCGTGGTCAACTCCCACACACGCGCCGGCGGCGCCGGTATAGAAATCTG
JMFF021K09+ CGAGTCACTCGCCGTGGTCAACTCCCACACACGCGCCGGCGGCGCCGGTATAGAAATCTG
JMFF008D19+ CGAGTCACTCGCCGTGGTCAACTCCCACACACGCGCCGGCGGCGCCGGTATAGAAATCTG
JMSF030F17+ CGAGTCACTCGCCGTGGTCAACTCCCACACACGCGCCGGCGGCGCCGGTATAGAAATCTG
                      ____________________________________________________________
consensus CGAGTCACTCGCCGTGGTCAACTCCCACACACGCGCCGGCGGCGCCGGTATAGAAATCTG
 
. : . : . : . : . : . :
JMFF027F18+ ATGCTGCTTATTCGAAATCCTAGGCGACGACTTACTGGACATATCAGGTGAAACCATCTC
JMFF021K09+ ATGCTGCTTATTCGAAATCCTAGGCGACGACTTACTGGACATATCAGGTGAAACCATCTC
JMFF008D19+ ATGCTGCTTATTCGAAATCCTAGGCGACGACTTACTGGACATATCAGGTGAAACCATCTC
JMSF030F17+ ATGCTGCTTATTCGAAATCCTAGGCGACGACTTACTGGACATATCAGGTGAAACCATCTC
                      ____________________________________________________________
consensus ATGCTGCTTATTCGAAATCCTAGGCGACGACTTACTGGACATATCAGGTGAAACCATCTC
 
. : . : . : . : . : . :
JMFF027F18+ CGTCTTCCGATCAAAATCCAGCATTTTTCATAAAACCAAAGCAATCAAATCAACAAAGAA
JMFF021K09+ CGTCTTCCGATCAAAATCCAGCATTTTTCATAAAACCAAAGCAATCAAATCAACAAAGAA
JMFF008D19+ CGTCTTCCGATCAAAATCCAGCATTTTTCATAAAACCAAAGCAATCAAATCAACAAAGAA
JMSF030F17+ CGTCTTCCGATCAAAATCCAGCATTTTTCATAAAACCAAAGCAATCAAATCAACAAAGAA
                      ____________________________________________________________
consensus CGTCTTCCGATCAAAATCCAGCATTTTTCATAAAACCAAAGCAATCAAATCAACAAAGAA
 
. : . : . : . : . : . :
JMFF027F18+ TGCAAGAACAAATATTCAATATTC-AAAAAATAAATAAATAAAGAAA
JMFF021K09+ TGCAAGAACAAATATTCAATATTC-AAAAAATAAATAAATAAAGAAA
JMFF008D19+ TGCAAGAACAAATATTCAATATTC-AAAAAATAAATAAATAAAGAAA
JMSF030F17+ TGCAAGAACAAATATTCAATATTCAAAAAAATAAATAAATAAAGAAATCCTTTACTTTCC
                      ____________________________________________________________
consensus TGCAAGAACAAATATTCAATATTC-AAAAAATAAATAAATAAAGAAATCCTTTACTTTCC