Previous Contig 006658:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011M07Sequence229006658 (6)gb:AY054238_15630583e-07Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.689022448gb:ATAC011698_15433745e-74Arabidopsis thaliana chromosome III BAC T11I18 genomic sequence, complete sequen
JMSF030F06Sequence601006658 (6)gb:AY054238_15630582e-49Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.
JMSF038K22Sequence605006658 (6)gb:AY054238_15630582e-49Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.814006658 (6)gb:AY054238_15630582e-19Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.
JMSF045D16Sequence802006658 (6)gb:AY054238_15630588e-61Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.728006658 (6)gb:AY054238_15630584e-13Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045D16- CC
rJMSF038K22- ATCCTTCAGAATCTTATACACACTCCATTTAATGAATTGAAAAGAAACACC
                      ____________________________________________________________
consensus ATCCTTCAGAATCTTATACACACTCCATTTAATGAATTGAAAAGAAACACC
 
. : . : . : . : . : . :
rJMSF045D16- TCATATTACATTATTTTGTACCCAAATACTGCTAATATGTCACATAGTTGTCAAGAAACC
rJMSF038K22- TCATATTACATTATTTTGTACCCAAATACTGCTAATATGTCACATAGTTGTCAAGAAACC
                      ____________________________________________________________
consensus TCATATTACATTATTTTGTACCCAAATACTGCTAATATGTCACATAGTTGTCAAGAAACC
 
. : . : . : . : . : . :
rJMSF045D16- AATAATCAATGATAGAGGGTTGTCTAGCCTGGATGGGGGACCCGACCCACTTTTCCTTCC
rJMSF038K22- AATAATCAATGATAGAGGGTTGTCTAGCCTGGATGGGGGACCCGACCCACTTTTCCTTCC
                      ____________________________________________________________
consensus AATAATCAATGATAGAGGGTTGTCTAGCCTGGATGGGGGACCCGACCCACTTTTCCTTCC
 
. : . : . : . : . : . :
rJMSF045D16- ATTTCTTCCCCGCCGGCGCTGGAATAGGCCGGAACTGTTCCACCATTTCTGGCCCCATAA
rJMSF038K22- ATTTCTTCCCCGCCGGCGCTGGAATAGGCCGGAACTGTTCCACCATTTCTGGCCCCATAA
                      ____________________________________________________________
consensus ATTTCTTCCCCGCCGGCGCTGGAATAGGCCGGAACTGTTCCACCATTTCTGGCCCCATAA
 
. : . : . : . : . : . :
rJMSF045D16- AGAACAGCCGGGTTTATTTCATGGCTGTCCAGACCCATAACAGGCCTCATGCCACCATAA
rJMSF038K22- AGAACAGCCGGGTTTATTTCATGGCTGTCCAGACCCATAACAGGCCTCATGCCACCATAA
                      ____________________________________________________________
consensus AGAACAGCCGGGTTTATTTCATGGCTGTCCAGACCCATAACAGGCCTCATGCCACCATAA
 
. : . : . : . : . : . :
rJMSF045D16- ACTTGGCCTATACTTGAAACTTGTTGGGGAAGCCCGACGGGTACTTGACCCGGAATGACC
rJMSF038K22- ACTTGGCCTATACTTGAAACTTGTTGGGGAAGCCCGACGGGTACTTGACCCGGAATGACC
                      ____________________________________________________________
consensus ACTTGGCCTATACTTGAAACTTGTTGGGGAAGCCCGACGGGTACTTGACCCGGAATGACC
 
. : . : . : . : . : . :
rJMSF045D16- TGATAGGGTTGAACGTATTGACCTCGTTGCGGAATTGGATGTGCCGGCGGGTGGCTGCCG
rJMSF038K22- TGATAGGGTTGAACGTATTGACCTCGTTGCGGAATTGGATGTGCCGGCGGGTGGCTGCCG
                      ____________________________________________________________
consensus TGATAGGGTTGAACGTATTGACCTCGTTGCGGAATTGGATGTGCCGGCGGGTGGCTGCCG
 
. : . : . : . : . : . :
rJMSF045D16- CCGGCGGCCTGAACTGGTCCGACTCCGGGGACGTAATAAATGGGCATGGGTTGAACTTGT
rJMSF038K22- CCGGCGGCCTGAACTGGTCCGACTCCGGGGACGTAATAAATGGGCATGGGTTGAACTTGT
                      ____________________________________________________________
consensus CCGGCGGCCTGAACTGGTCCGACTCCGGGGACGTAATAAATGGGCATGGGTTGAACTTGT
 
. : . : . : . : . : . :
rJMSF045D16- GGTCCTGGGACTGTGTAATGCCAATACGGGCTACCCGGATACCCGGATTGCTGGTGCGGG
rJMSF038K22- GGTCCTGGGACTGTGTAATGCCAATACGGGCTACCCGGATACCCGGATTGCTGGTGCGGG
                      ____________________________________________________________
consensus GGTCCTGGGACTGTGTAATGCCAATACGGGCTACCCGGATACCCGGATTGCTGGTGCGGG
 
. : . : . : . : . : . :
rJMSF045D16- GCGGCAGTCTCAATCGACGTTGCTTTGGGTTCGGCGGCGGGGATAGGTTGATCGGGCTTT
rJMSF038K22- GCGGCAGTCTCAATCGACGTTGCTTTGGGTTCGGCGGCGGGGATAGGTTGATCGGGCTTT
                      ____________________________________________________________
consensus GCGGCAGTCTCAATCGACGTTGCTTTGGGTTCGGCGGCGGGGATAGGTTGATCGGGCTTT
 
. : . : . : . : . : . :
rJMSF045D16- GTTTTCACCGGCGGGAGATCCGGCATCACGGTCACGTTAGGCGTGGCCAGCGCCGATGAG
rJMSF038K22- GTTTTCACCGGCGGGAGATCCGGCATCACGGTCACGTTAGGCGTGGCCAGCGCCGATGAG
JMSF045D16+ ACGTTAGGCGTGGCCAGCGCCGATGAG
                      ____________________________________________________________
consensus GTTTTCACCGGCGGGAGATCCGGCATCACGGTCACGTTAGGCGTGGCCAGCGCCGATGAG
 
. : . : . : . : . : . :
rJMSF045D16- GTGGAGCAGAACGGGGAAGAAACCGCCGGCGCCGGCGAACCCGGATCCGAATTCGACGCG
rJMSF038K22- GTGGAGCAGAACGGGGAAGAAACCGCCGGCGCCGGCGAACCCGGATCCGAATTCGACGCG
JMSF045D16+ GTGGAGCAGAACGGGGAAGAAACCGCCGGCGCCGGCGAACCCGGATCCGAATTCGACGCG
                      ____________________________________________________________
consensus GTGGAGCAGAACGGGGAAGAAACCGCCGGCGCCGGCGAACCCGGATCCGAATTCGACGCG
 
. : . : . : . : . : . :
rJMSF045D16- TTCTCGTGGAAAAGATGCTTGTTCTTCATCATCCGGGATTCACGGAGAAGCGGCGGCTCG
rJMSF038K22- TTCTCGTGGAAAAGATGCTTGTTCTTCATCATCCGGGATTCACGGAGAAGCGGCGGCTCG
JMSF045D16+ TTCTCGTGGAAAAGATGCTTGTTCTTCATCATCCGGGATTCACGGAGAAGCGGCGGCTCG
                      ____________________________________________________________
consensus TTCTCGTGGAAAAGATGCTTGTTCTTCATCATCCGGGATTCACGGAGAAGCGGCGGCTCG
 
. : . : . : . : . : . :
rJMSF045D16- TCGGCG
rJMSF038K22- TCGGCGTTTTCCAACCCGAACAAATAATCCGGCACCTCCGACA
JMSF045D16+ TCGGCGTTTTCCAACCCGAACAAATAATCCGGCACCTCCGACACAATCGACGACGCCTCC
JMSF038K22+ C
JMSF030F06+ C
                      ____________________________________________________________
consensus TCGGCGTTTTCCAACCCGAACAAATAATCCGGCACCTCCGACACAATCGACGACGCCTCC
 
. : . : . : . : . : . :
JMSF045D16+ GACCTCCCGCGCTCCAGCCCCCGACCCGACCCGCCGTTAAGCGCGTCGAAAAACCAGTGC
JMSF038K22+ GACCTCCCGCGCTCCAGCCCCCGACCCGACCCGCCGTTAAGCGCGTCGAAAAACCAGTGC
JMSF030F06+ GACCTCCCGCGCTCCAGCCCCCGACCCGACCCGCCGTTAAGCGCGTCGAAAAACCAGTGC
                      ____________________________________________________________
consensus GACCTCCCGCGCTCCAGCCCCCGACCCGACCCGCCGTTAAGCGCGTCGAAAAACCAGTGC
 
. : . : . : . : . : . :
JMSF045D16+ TCCCGCTTAGCCGACCCGTCGAGAATAGAATTAATCGTGCTGGCTCTCGAATCCGCGTCG
JMSF038K22+ TCCCGCTTAGCCGACCCGTCGAGAATAGAATTAATCGTGCTGGCTCTCGAATCCGCGTCG
JMSF030F06+ TCCCGCTTAGCCGACCCGTCGAGAATAGAATTAATCGTGCTGGCTCTCGAATCCGCGTCG
                      ____________________________________________________________
consensus TCCCGCTTAGCCGACCCGTCGAGAATAGAATTAATCGTGCTGGCTCTCGAATCCGCGTCG
 
. : . : . : . : . : . :
JMSF045D16+ GTCGGAAAAAGGAAAAGCCGCAGACGCGCCGCCGCCTTGTGACTCTGCGCCACCACGCGG
JMSF038K22+ GTCGGAAAAAGGAAAAGCCGCAGACGCGCCGCCGCCTTGTGACTCTGCGCCACCACGCGG
JMSF030F06+ GTCGGAAAAAGGAAAAGCCGCAGACGCGCCGCCGCCTTGTGACTCTGCGCCACCACGCGG
                      ____________________________________________________________
consensus GTCGGAAAAAGGAAAAGCCGCAGACGCGCCGCCGCCTTGTGACTCTGCGCCACCACGCGG
 
. : . : . : . : . : . :
JMSF045D16+ TCATACTCGTCCATCATATTCTCCACGTCCTCGTCCGTCGTGACCGTAATCAACGAGTCC
JMSF038K22+ TCATACTCGTCCATCATATTCTCCACGTCCTCGTCCGTCGTGACCGTAATCAACGAGTCC
JMSF030F06+ TCATACTCGTCCATCATATTCTCCACGTCCTCGTCCGTCGTGACCGTAATCAACGAGTCC
                      ____________________________________________________________
consensus TCATACTCGTCCATCATATTCTCCACGTCCTCGTCCGTCGTGACCGTAATCAACGAGTCC
 
. : . : . : . : . : . :
JMSF045D16+ AGGTCCTCGTTGGGAAGCTGGTACTTCACGACCACGCTGGCCGTGCCGGCGATCTTGGAG
JMSF038K22+ AGGTCCTCGTTGGGAAGCTGGTACTTCACGACCACGCTGGCCGTGCCGGCGATCTTGGAG
JMSF030F06+ AGGTCCTCGTTGGGAAGCTGGTACTTCACGACCACGCTGGCCGTGCCGGCGATCTTGGAG
                      ____________________________________________________________
consensus AGGTCCTCGTTGGGAAGCTGGTACTTCACGACCACGCTGGCCGTGCCGGCGATCTTGGAG
 
. : . : . : . : . : . :
JMSF045D16+ AGCTTAACGAGGAGGGACGAGAATGACGCGTGGCGGTTCAACGCGACTATGCGCGTGTCG
JMSF038K22+ AGCTTAACGAGGAGGGACGAGAATGACGCGTGGCGGTTCAACGCGACTATGCGCGTGTCG
JMSF030F06+ AGCTTAACGAGGAGGGACGAGAATGACGCGTGGCGGTTCAACGCGACTATGCGCGTGTCG
                      ____________________________________________________________
consensus AGCTTAACGAGGAGGGACGAGAATGACGCGTGGCGGTTCAACGCGACTATGCGCGTGTCG
 
. : . : . : . : . : . :
JMSF045D16+ CCGCCGACGTAGCGGAGCTGATTGTCGTGCGGCCGGGGAAGGATCTTCCCGCCGAAACTG
JMSF038K22+ CCGCCGACGTAGCGGAGCTGATTGTCGTGCGGCCGGGGAAGGATCTTCCCGCCGAAACTG
JMSF011M07+ ACGTAGCGGAGCTGATTGTCGTGCGGCCGGGGAAGGATCTTCCCGCCGAAACTG
JMSF030F06+ CCGCCGACGTAGCGGAGCTGATTGTCGTGCGGCCGGGGAAGGATCTTCCCGCCGAAACTG
                      ____________________________________________________________
consensus CCGCCGACGTAGCGGAGCTGATTGTCGTGCGGCCGGGGAAGGATCTTCCCGCCGAAACTG
 
. : . : . : . : . : . :
JMSF045D16+ CACATGAAGCGGACGCGTGGCAGCTGCTGCATGGAGACGCCATCGTCGGCGAGGTTTTGG
JMSF038K22+ CACATGAAGCGGACGCGTGGCAGCTGCTGCATGGAGACGCCATCGTCGGCGAGGTTTTGG
JMSF011M07+ CACATGAAGCGGACGCGTGGCAGCTGCTGCATGGAGACGCCATCGTCGGCGAGGTTTTGG
JMSF030F06+ CACATGAAGCGGACGCGTGGCAGCTGCTGCATGGAGACGCCATCGTCGGCGAGGTTTTGG
                      ____________________________________________________________
consensus CACATGAAGCGGACGCGTGGCAGCTGCTGCATGGAGACGCCATCGTCGGCGAGGTTTTGG
 
. : . : . : . : . : . :
JMSF045D16+ TGGTGCTCCGACCGCGGCGTCGAAGCGACGGAGTCGCCTGCGTTGGACTCCAACTCCATA
JMSF038K22+ TGGTGCTCCGACCGCGGCGTCGAAGCGACGGAGTCGCCTGCGTTGGACTCCAACTCCATA
JMSF011M07+ TGGTGCTCCGACCGCGGCGTCGAAGCGACGGAGTCGCCTGCGTTGGACTCCAACTCCATA
JMSF030F06+ TGGTGCTCCGACCGCGGCGTCGAAGCGACGGAGTCGCCTGCGTTGGACTCCAACTCCATA
                      ____________________________________________________________
consensus TGGTGCTCCGACCGCGGCGTCGAAGCGACGGAGTCGCCTGCGTTGGACTCCAACTCCATA
 
. : . : . : . : . : . :
JMSF045D16+ GCTGCGTAGCGTGCCGCCATTACTGCAATAATATTGAGAATATACAATATAGCT
JMSF038K22+ GCTGCGTAGCGTGCCGCCATTACTGCAATAATATTGAGAATATACAATATAGCT
JMSF011M07+ GCTGCGTAGCGTGCCGCCATTACTGCAATAATATTGAGAATATACAATATAGCT
JMSF030F06+ GCTGCGTAGCGTGCCGCCATTACTGCAATAATATTGAGAATATACAATATAGCTGGGCAC
                      ____________________________________________________________
consensus GCTGCGTAGCGTGCCGCCATTACTGCAATAATATTGAGAATATACAATATAGCTGGGCAC