Previous Contig 006654:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016I22Sequence579006654 (4)gb:AY029317_15592262e-26Zea mays seven transmembrane protein Mlo6 mRNA, complete cds.726009360 (3)gb:AF369566_17919342e-49Arabidopsis thaliana membrane protein Mlo5 mRNA, complete cds.
JMFF024K01Sequence509006654 (4)gb:AY029317_15592261e-26Zea mays seven transmembrane protein Mlo6 mRNA, complete cds.752009360 (3)gb:AF369566_17919341e-52Arabidopsis thaliana membrane protein Mlo5 mRNA, complete cds.
JMSF014D10Sequence207006654 (4)807009360 (3)gb:AC135431_17424152e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B12, complete seq
JMSF030E11Sequence501006654 (4)gb:AC025815_15396102e-06Arabidopsis thaliana chromosome 1 BAC T8D8 genomic sequence, complete sequence.617010832 (36)gb:AB096718_15258272e-68Physcomitrella patens PpTUA1 mRNA for alpha tubulin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016I22+ CTGTCAGCTGATAAAAGTCTATGTTCATACCACAGAAGCCTTCTATGGTGTCC
                      ____________________________________________________________
consensus CTGTCAGCTGATAAAAGTCTATGTTCATACCACAGAAGCCTTCTATGGTGTCC
 
. : . : . : . : . : . :
JMFF024K01+ CGTGTATAGGATACTTAGCAGGGCATGGCAACATAGTGTTGGC
JMFF016I22+ CTCTTCGTGTCCCCCTTCGTGTATAGGATACTTAGCAGGGCATGGCAACATAGTGTTGGC
                      ____________________________________________________________
consensus CTCTTCGTGTCCCCCTTCGTGTATAGGATACTTAGCAGGGCATGGCAACATAGTGTTGGC
 
. : . : . : . : . : . :
JMFF024K01+ AGCAGTTGCAGGAATGCAAATCTTAGCAATGTAATTCTGACCAAATGTTAAGAGGAGGGA
JMFF016I22+ AGCAGTTGCAGGAATGCAAATCTTAGCAATGTAATTCTGACCAAATGTTAAGAGGAGGGA
                      ____________________________________________________________
consensus AGCAGTTGCAGGAATGCAAATCTTAGCAATGTAATTCTGACCAAATGTTAAGAGGAGGGA
 
. : . : . : . : . : . :
JMFF024K01+ AATAAATCCCAGAACCATGAGCTCACCCTTAATCTTCTGCAAAGCTTCATACAGTGCTCT
JMFF016I22+ AATAAATCCCAGAACCATGAGCTCACCCTTAATCTTCTGCAAAGCTTCATACAGTGCTCT
JMSF030E11+ TGCAAAGCTTCATACA--GCTCT
                      ____________________________________________________________
consensus AATAAATCCCAGAACCATGAGCTCACCCTTAATCTTCTGCAAAGCTTCATACAGTGCTCT
 
. : . : . : . : . : . :
JMFF024K01+ CTTTCGTTTTCTCTCAAAGGTCGATCCAACTGAATGAAGAAATTTCTCTAAGAGTATAGA
JMFF016I22+ CTTTCGTTTTCTCTCAAAGGTCGATCCAACTGAATGAAGAAATTTCTCTAAGAGTATAGA
JMSF030E11+ CTTTCGTTTTCTCTCAAAGGTCGATCCAACTGAATGAAGAAATTTCTCTAAGAGTATAGA
                      ____________________________________________________________
consensus CTTTCGTTTTCTCTCAAAGGTCGATCCAACTGAATGAAGAAATTTCTCTAAGAGTATAGA
 
. : . : . : . : . : . :
JMFF024K01+ AATGATAATGATGACTACACAGACCAATGCTACTGCCCATGTGGGTGTCTGGTCCAGTTC
JMFF016I22+ AATGATAATGATGACTACACAGACCAATGCTACTGCCCATGTGGGTGTCTGGTCCAGTTC
JMSF030E11+ AATGATAATGATGACTACACAGACCAATGCTACTGCCCATGTGGGTGTCTGGTCCAGTTC
                      ____________________________________________________________
consensus AATGATAATGATGACTACACAGACCAATGCTACTGCCCATGTGGGTGTCTGGTCCAGTTC
 
. : . : . : . : . : . :
JMFF024K01+ CCTTTCAGAAGCTCCTCCTCCTCCTGCCATTTTAAATTGTTCCTTTTCCTATTCCCTAAT
JMFF016I22+ CCTTTCAGAAGCTCCTCCTCCTCCTGCCATTTTAAATTGTTCCTTTTCCTATTCCCTAAT
JMSF014D10+ CTCCTGCCATTTTAAATTGTTCCTTTTCCTATTCCCTAAT
JMSF030E11+ CCTTTCAGAAGCTCCTCCTCCTCCTGCCATTTTAAATTGTTCCTTTTCCTATTCCNTAAT
                      ____________________________________________________________
consensus CCTTTCAGAAGCTCCTCCTCCTCCTGCCATTTTAAATTGTTCCTTTTCCTATTCCCTAAT
 
. : . : . : . : . : . :
JMFF024K01+ CCTAAAATTACTCAATCCAATAGGATAGGAGCACCACCTTCCCCAGGGGTAGGATACGGT
JMFF016I22+ CCTAAAATTACTCAATCCAATAGGATAGGAGCACCACCTTCCCCAGGGGTAGGATACGGT
JMSF014D10+ CCTAAAATTACTCAATCCAATAGGATAGGAGCACCACCTTCCCCAGGGGTAGGATACGGT
JMSF030E11+ CCTAAAATTACTCAATCCAATAGGATAGGAGCACCACCTTCCCCAGGGGTAGGATACGGT
                      ____________________________________________________________
consensus CCTAAAATTACTCAATCCAATAGGATAGGAGCACCACCTTCCCCAGGGGTAGGATACGGT
 
. : . : . : . : . : . :
JMFF024K01+ ACGGTGCTGCACTTTTGGAAAATAATCAAACACCTTGGGCGCAGCCAAAAGTGCAGAGGG
JMFF016I22+ ACGGTGCTGCACTTTTGGAAAATAATCAAACACCTTGGGCGCAGCCAAAAGTGCAGAGGG
JMSF014D10+ ACGGTGCTGCACTTTTGGAAAATAATCAAACACCTTGGGCGCAGCCAAAAGTGCAGAGGG
JMSF030E11+ ACGGTGCTGCACTTTTGGAAAATAATCAAACACCTTGGGCGCAGCCAAAAGTGCAGAGGG
                      ____________________________________________________________
consensus ACGGTGCTGCACTTTTGGAAAATAATCAAACACCTTGGGCGCAGCCAAAAGTGCAGAGGG
 
. : . : . : . : . : . :
JMFF024K01+ ACCGACCAGCGCCCGGGTACCGGTGGCTCTGGATTTGGATTGGG
JMFF016I22+ ACCGACCAGCGCCCGGGTACCGGTGGCTCTGGATTTGGATTGGG
JMSF014D10+ ACCGACCAGCGCCCGGGTACCGGTGGCTCTGGATTTGGATTGGG
JMSF030E11+ ACCGACCAGCGCCCGGGTACCGGTGGCTCTGGATNTGGATTGGGCCAAACTCCATTGCAA
                      ____________________________________________________________
consensus ACCGACCAGCGCCCGGGTACCGGTGGCTCTGGATTTGGATTGGGCCAAACTCCATTGCAA
 
. : . : . : . : . : . :
JMSF030E11+ ACCTGCATTTGCTTATATTCTAGCTAGGAGGAGAGCAGGTGCCCGTTCAATGCCAAACTA
                      ____________________________________________________________
consensus ACCTGCATTTGCTTATATTCTAGCTAGGAGGAGAGCAGGTGCCCGTTCAATGCCAAACTA
 
. : . : . : . : . : . :
JMSF030E11+ GATAGAATTNTGCGCTCCACCAAGCTTCTTAGCTTCCACTTGTCATTTCCAAAATGTTTC
                      ____________________________________________________________
consensus GATAGAATTNTGCGCTCCACCAAGCTTCTTAGCTTCCACTTGTCATTTCCAAAATGTTTC