Previous Contig 006642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031B17Sequence645006642 (3)gb:AY085588_15706566e-15Arabidopsis thaliana clone 158575 mRNA, complete sequence.
JMSF019L21Sequence248006642 (3)736012697 (2)gb:AY093019_15749738e-53Arabidopsis thaliana unknown protein (At5g12160:At5g12170) mRNA, complete cds.>g
JMSF030B21Sequence660006642 (3)gb:AY085588_15706568e-13Arabidopsis thaliana clone 158575 mRNA, complete sequence.631012697 (2)gb:AY093019_15749733e-32Arabidopsis thaliana unknown protein (At5g12160:At5g12170) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031B17+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFF031B17+ GGAGTTTTAGGCAANGAAAGCATTTCATTGGTAACCTTGCCAGCATGGTAGNGAAGAAAC
JMSF030B21+ C
                      ____________________________________________________________
consensus GGAGTTTTAGGCAANGAAAGCATTTCATTGGTAACCTTGCCAGCATGGTAGNGAAGAAAC
 
. : . : . : . : . : . :
JMFF031B17+ AGGATAGAAGAGTATNCAATCACATNCCCGAACGTGGCGAGNTGAGCCAAGAAGAAGGGA
JMSF030B21+ AGGATAGAAGAGTATACAATCACATACCCGAACGTGGCGAGCTGAGCCAAGAAGAAGGGA
                      ____________________________________________________________
consensus AGGATAGAAGAGTATACAATCACATACCCGAACGTGGCGAGCTGAGCCAAGAAGAAGGGA
 
. : . : . : . : . : . :
JMFF031B17+ TATTGTTTGAGTGGGACAAGAGCGAGCTTGTAGAGGACCCGATTACCAACGCCCAGGACC
JMSF030B21+ TATTGTTTGAGTGGGACAAGAGCGAGCTTGTAGAGGACCCGATTACCAACGCCCAGGACC
                      ____________________________________________________________
consensus TATTGTTTGAGTGGGACAAGAGCGAGCTTGTAGAGGACCCGATTACCAACGCCCAGGACC
 
. : . : . : . : . : . :
JMFF031B17+ ACCGTAGCCGTTGCTGCGACCAAAACTTCCGCCNTTACGATTCCCACCGCCTTTCCCGCA
JMSF030B21+ ACCGTAGCCGTTGCTGCGACCAAAACTTCCGCC-CTACGATTCCCACCGCCTTTCCCGCA
                      ____________________________________________________________
consensus ACCGTAGCCGTTGCTGCGACCAAAACTTCCGCCNTTACGATTCCCACCGCCTTTCCCGCA
 
. : . : . : . : . : . :
JMFF031B17+ ACTCTCAACCGAATCCTCCACTCCTTGGAGATCTCCAACCGCACACCAGCAACGCCTCTT
JMSF030B21+ ACTCTCAACCGAATCCTCCACTCCTTGGAGATCTCCAACCGCACACCAGGAACGCCTCTT
                      ____________________________________________________________
consensus ACTCTCAACCGAATCCTCCACTCCTTGGAGATCTCCAACCGCACACCAGGAACGCCTCTT
 
. : . : . : . : . : . :
JMFF031B17+ ACGACTCCTCCTCACCTCTCCGAACTTCCCGTTCGCTCCCGCCGGCGTCGCGGCGGCCTC
JMSF030B21+ ACGACTCCTCCTCACCTCTCCGAACTTCCCGTTCGCTCCCGCCGGCGTCGCGGCGGCCTC
                      ____________________________________________________________
consensus ACGACTCCTCCTCACCTCTCCGAACTTCCCGTTCGCTCCCGCCGGCGTCGCGGCGGCCTC
 
. : . : . : . : . : . :
JMFF031B17+ CACCGCCCATTGCCTCGTCGCCGTCGCTCTCAGAACGATTTCCGGCCGCCGCCGCCGCCC
JMSF030B21+ CACCGCCCATTGCCTCGTCGCCGTCGCTCTCAGAACGATTTCCGGCCGCCGCCGCCGCCC
                      ____________________________________________________________
consensus CACCGCCCATTGCCTCGTCGCCGTCGCTCTCAGAACGATTTCCGGCCGCCGCCGCCGCCC
 
. : . : . : . : . : . :
JMFF031B17+ CTGCAGCAGCCACGGCGAGATAACGTGCTGGAATTCTGCTCCCCGCCTGCGTAGATGCAA
JMSF019L21+ TGCGTAGATGCAA
JMSF030B21+ CTGCAGCAGCCACGGCGAGATAACGTGCTGGAATTCTGCTCCCCGCCTGCGTAGATGCAA
                      ____________________________________________________________
consensus CTGCAGCAGCCACGGCGAGATAACGTGCTGGAATTCTGCTCCCCGCCTGCGTAGATGCAA
 
. : . : . : . : . : . :
JMFF031B17+ ATGACGGCTCCCTTCCGGCCCCGCCTGGGTTCCGATTGAGCCGCCGGTTATTGGGCGACT
JMSF019L21+ ATGACGGCTCCCTTCCGGCCCCGCCTGGGTTCCGATTGAGCCGCCGGTTATTGGGCGACT
JMSF030B21+ ATGACGGCTCCCTTCCGGCCCCGCCTGGGTTCCGATTGAGCCGCCGGTTATTGGGCGACT
                      ____________________________________________________________
consensus ATGACGGCTCCCTTCCGGCCCCGCCTGGGTTCCGATTGAGCCGCCGGTTATTGGGCGACT
 
. : . : . : . : . : . :
JMFF031B17+ CCAAACCGTCATGTTTGCTCCTCCCCCCTCACTTTTGATCCTTAATTATTTCTACAAATA
JMSF019L21+ CCAAACCGTCATGTTTGCTCCTCCCCCCTCACTTTTGATCCTTAATTATTTCTACAAATA
JMSF030B21+ CCAAACCGTCATGTTTGCTCCTCCCCCCTCACTTTTGATCCTTAATTATTTCTACAAATA
                      ____________________________________________________________
consensus CCAAACCGTCATGTTTGCTCCTCCCCCCTCACTTTTGATCCTTAATTATTTCTACAAATA
 
. : . : . : . : . : . :
JMFF031B17+ CTTCTGAACAAATTTCTGTCTAAGCTTCAAAATTGGAAGACGAT
JMSF019L21+ CTTCTGAACAAATTTCTGTCTAAGCTTCAAAATTGGAAGACGATGAAAGTTGAAGAGGAT
JMSF030B21+ CTTCTGAACAAATTTCTGTCTAAGCTTCAAAATTGGAAGACGATGAAAGTTGAAGAGGAT
                      ____________________________________________________________
consensus CTTCTGAACAAATTTCTGTCTAAGCTTCAAAATTGGAAGACGATGAAAGTTGAAGAGGAT
 
. : . : . : . : . : . :
JMSF019L21+ CGAACAGAGATATATAGTACTATACTACTATGTAGAGTGGGAGAGAGCAATTA
JMSF030B21+ CGAACAGAGATATATAGTACTATACTACTATGTAGAGTGGGAGAGAGCAATTATGCTTTC
                      ____________________________________________________________
consensus CGAACAGAGATATATAGTACTATACTACTATGTAGAGTGGGAGAGAGCAATTATGCTTTC