Previous Contig 006633:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021H04Sequence577001077 (2)gb:AY850142_16308151e-67Glycine max senescence-inducible chloroplast stay-green protein 2 (SGR2) mRNA, c492006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFF040F12Sequence608006633 (28)pir|S71562|S715621e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFF040K20Sequence295006633 (28)pir|S71562|S715623e-15drought-induced protein SDi-6 - common sunflower (fragment)604006633 (28)pir|S71562|S715623e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN001H07Sequence477006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN003N20Sequence614006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN004L11Sequence610006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN006B10Sequence587006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN008M11Sequence607006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN014B06Sequence625006633 (28)pir|S71562|S715627e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN014H19Sequence612006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN017O24Sequence577006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN029K03Sequence603006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN031J17Sequence574006633 (28)pir|S71562|S715623e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN034D12Sequence566006633 (28)pir|S71562|S715622e-14drought-induced protein SDi-6 - common sunflower (fragment)
JMFN034J17Sequence606006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN034O09Sequence615006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN034P16Sequence633006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN036A13Sequence639006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN040O14Sequence607006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFN044M19Sequence221006633 (28)pir|S71562|S715622e-11drought-induced protein SDi-6 - common sunflower (fragment)
JMFS065E03Sequence628006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFS075H10Sequence621006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMFS089H07Sequence615006633 (28)pir|S71562|S715624e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMSF029P11Sequence667006633 (28)pir|S71562|S715623e-18drought-induced protein SDi-6 - common sunflower (fragment)633006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)
JMSF051P14Sequence613006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)547006633 (28)pir|S71562|S715622e-18drought-induced protein SDi-6 - common sunflower (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034D12- GAGAACTAGTCTCGAGXXXXX
                      ____________________________________________________________
consensus GAGAACTAGTCTCGAGNNNNN
 
. : . : . : . : . : . :
JMFN034D12- XXXXXXXXXXXXXXXAAAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN036A13+ AAAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFS075H10+ AAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFS089H07+ CCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN014H19+ CATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN034O09+ CCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN003N20+ CATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN014B06+ TTAAAAACAACCATATTTATTATATATGAAGCAGATTACATGGGACA
JMFN034P16+ TTAAAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFS065E03+ CAACCATATTTATTATATATGAAGCAGATTAACATGGACA
JMFN034J17+ TATATATGAAGCAGATTAACATGGACA
JMFN040O14+ TATATATGAAGCAGATTAACATGGACA
JMFN029K03+ TATATGAAGCAGATTAACATGGACA
JMFN004L11+ TATATATGAAGCAGATTAACATGGACA
JMFN008M11+ AGCAGATTAACATGGACA
JMFN006B10+ A
rJMSF029P11- TATATATGAAGCAGATTAACATGGACA
JMSF051P14+ GACA
rJMFF040K20- GGACA
rJMFF040F12- GGACA
JMSF029P11+ AAAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNTTAAAAACAACCATATTTATTATATATGAAGCAGATTAACATGGACA
 
. : . : . : . : . : . :
JMFN034D12- GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN036A13+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFS075H10+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFS089H07+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN014H19+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN034O09+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN003N20+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN014B06+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN034P16+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFS065E03+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN034J17+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN040O14+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN029K03+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN031J17+ AATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN004L11+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN017O24+ ATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN008M11+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMFN006B10+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
rJMSF029P11- GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
JMSF051P14+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
rJMFF040K20- GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
rJMFF040F12- GTGAATACATATATGCAATATAATCATGCATAAGCTCATGCTCCACATTATCAATAATTA
rJMSF051P14- AATAATTA
JMSF029P11+ GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
                      ____________________________________________________________
consensus GTGAATACATATATGCAATATAATCATGCATAAGCACATGCTCCACATTATCAATAATTA
 
. : . : . : . : . : . :
JMFN034D12- TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN036A13+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFS075H10+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFS089H07+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN014H19+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN034O09+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN003N20+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN014B06+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN034P16+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFS065E03+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN034J17+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN040O14+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN029K03+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN031J17+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
rJMFF021H04- ATGTAAACCATANCACATAACATGNNAAT
JMFN004L11+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN017O24+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN008M11+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN006B10+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMFN001H07+ CATAGTACATAACATGTTAAT
rJMSF029P11- TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMSF051P14+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
rJMFF040K20- TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
rJMFF040F12- TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
rJMSF051P14- TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
JMSF029P11+ TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
                      ____________________________________________________________
consensus TTACAACAGACCAGCAAATTAGAAGTAGAAGATGTAAACCATAGTACATAACATGTTAAT
 
. : . : . : . : . : . :
JMFN034D12- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN036A13+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFS075H10+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFS089H07+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN014H19+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN034O09+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN003N20+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN014B06+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN034P16+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFS065E03+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN034J17+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN040O14+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN029K03+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN031J17+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
rJMFF021H04- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN004L11+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN017O24+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN008M11+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN006B10+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMFN001H07+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
rJMSF029P11- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMSF051P14+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
rJMFF040K20- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
rJMFF040F12- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
rJMSF051P14- AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
JMSF029P11+ AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
                      ____________________________________________________________
consensus AATAAAGTTTGTTAATCCCTCTTCAGAAAATCTCCGGCCGCCTTCATGAAATCTCCGGCG
 
. : . : . : . : . : . :
JMFN034D12- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN036A13+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFS075H10+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFS089H07+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN014H19+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN034O09+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN003N20+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN014B06+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN034P16+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFS065E03+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN034J17+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN040O14+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN029K03+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN031J17+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
rJMFF021H04- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN004L11+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN017O24+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN008M11+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN006B10+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMFN001H07+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
rJMSF029P11- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMSF051P14+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
rJMFF040K20- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
rJMFF040F12- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
rJMSF051P14- CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
JMSF029P11+ CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
                      ____________________________________________________________
consensus CCACCGTGGCTCTCGCCGGAGGGTTCCTTTTTCAGGGAGTCTTCACCCTGCTTAGCATTT
 
. : . : . : . : . : . :
JMFN034D12- TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN036A13+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFS075H10+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFS089H07+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN014H19+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN034O09+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN003N20+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN014B06+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN034P16+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFS065E03+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN034J17+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN040O14+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGAAGATAGCCC
JMFN029K03+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN031J17+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFF040K20+ GCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
rJMFF021H04- TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN004L11+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN017O24+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN008M11+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN006B10+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMFN001H07+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
rJMSF029P11- TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMSF051P14+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
rJMFF040K20- TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
rJMFF040F12- TCCTCCGCCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
rJMSF051P14- TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
JMSF029P11+ TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
                      ____________________________________________________________
consensus TCCTCCACCGCTTCACCGGCGGCGGCGGCGGCAGGCTGGCCGTACCCCCGGAGATAGCCC
 
. : . : . : . : . : . :
JMFN034D12- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN036A13+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFS075H10+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFS089H07+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN014H19+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN034O09+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN003N20+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN014B06+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN034P16+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFS065E03+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN034J17+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN040O14+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN029K03+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN031J17+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN044M19+ ACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFF040K20+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
rJMFF021H04- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN004L11+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN017O24+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN008M11+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN006B10+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMFN001H07+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
rJMSF029P11- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMSF051P14+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
rJMFF040K20- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
rJMFF040F12- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
rJMSF051P14- TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
JMSF029P11+ TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
                      ____________________________________________________________
consensus TCCGCTTTCTCCACGTACTGCCCGACTCCCGTGGTCTCGTCTAGCTTGCCGTATTTTTGG
 
. : . : . : . : . : . :
JMFN034D12- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN036A13+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFS075H10+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFS089H07+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN014H19+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN034O09+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN003N20+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN014B06+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN034P16+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFS065E03+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN034J17+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN040O14+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN029K03+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN031J17+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN044M19+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFF040K20+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
rJMFF021H04- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN004L11+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN017O24+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN008M11+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN006B10+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMFN001H07+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
rJMSF029P11- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMSF051P14+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
rJMFF040K20- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
rJMFF040F12- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
rJMSF051P14- GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
JMSF029P11+ GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
                      ____________________________________________________________
consensus GCGGCGTCGAGGAGGTTAGCTGCGGCGCCGGCCACTTCCCGTTTGTCGATTTCGGAATTC
 
. : . : . : . : . : . :
JMFN034D12- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN036A13+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFS075H10+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFS089H07+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN014H19+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN034O09+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN003N20+ TTGTTCTGTAACTGAGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN014B06+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN034P16+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFS065E03+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN034J17+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN040O14+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN029K03+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN031J17+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN044M19+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFF040K20+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
rJMFF021H04- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN004L11+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN017O24+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN008M11+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN006B10+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMFN001H07+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
rJMSF029P11- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMSF051P14+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
rJMFF040K20- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
rJMFF040F12- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
rJMSF051P14- TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
JMSF029P11+ TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
                      ____________________________________________________________
consensus TTGTTCTGTAACTGGGCTTGAGCGGCTTCGGCCACCACCTTAGCACTGGAGAAGAGGTCG
 
. : . : . : . : . : . :
JMFN034D12- GCGTT
JMFN036A13+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFS075H10+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFS089H07+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN014H19+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN034O09+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN003N20+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN014B06+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN034P16+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFS065E03+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN034J17+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN040O14+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN029K03+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN031J17+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN044M19+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACC
JMFF040K20+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
rJMFF021H04- GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN004L11+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN017O24+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN008M11+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN006B10+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMFN001H07+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
rJMSF029P11- GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMSF051P14+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
rJMFF040K20- GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
rJMFF040F12- GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
rJMSF051P14- GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
JMSF029P11+ GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
                      ____________________________________________________________
consensus GCGTTCGAATGGCCGGAGTGGTCGGAAGGTTTTTGGTCGGACTCGTGGCCACCGTCTAAG
 
. : . : . : . : . : . :
JMFN036A13+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGG
JMFS075H10+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTG
JMFS089H07+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGA
JMFN014H19+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTT
JMFN034O09+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGA
JMFN003N20+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGA
JMFN014B06+ GCGTTCTT-AGAAAATCCATGG-AGTTATGGAGTTTT
JMFN034P16+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGG
JMFS065E03+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTG
JMFN034J17+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGAT
JMFN040O14+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATT
JMFN029K03+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGA
JMFN031J17+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTG
JMFF040K20+ GCGTTCTTGAGAAAATCCA
rJMFF021H04- GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTT
JMFN004L11+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGG
JMFN017O24+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGC
JMFN008M11+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGC
JMFN006B10+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTT
JMFN001H07+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTT
rJMSF029P11- GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGTC
JMSF051P14+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGTC
rJMFF040K20- GCGTTCTTGAGAAAATCCATGGAAGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGT
rJMFF040F12- GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGT
rJMSF051P14- GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGTC
JMSF029P11+ GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGTC
                      ____________________________________________________________
consensus GCGTTCTTGAGAAAATCCATGG-AGTTATGGAGTTTTGATTTGGTTTTGCTTGGCTTGTC