Previous Contig 006625:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017K15Sequence608006625 (4)781009019 (2)gb:BT002752_16363556e-32Arabidopsis thaliana clone C104851 putative protein kinase (At5g14720) mRNA, com
JMFS152D08Sequence483006625 (4)
JMFS168H03Sequence620006625 (4)
JMSF029O07Sequence611006625 (4)730009019 (2)gb:BT002752_16363556e-28Arabidopsis thaliana clone C104851 putative protein kinase (At5g14720) mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS168H03+ TATGACATAACATAANAATGCCCTTTNTGCCCTAAGCTCTCAAAGAAGA
JMFF017K15+ CAAAGAAGA
JMSF029O07+ CAAAGAAGA
                      ____________________________________________________________
consensus TATGACATAACATAANAATGCCCTTTNTGCCCTAAGCTCTCAAAGAAGA
 
. : . : . : . : . : . :
JMFS168H03+ TAAAAAGGATGTTGGAAAGATCCAAAATTGTATGACATTTCTTTTTATGATATACCATTT
JMFF017K15+ TAAAAAGGATGTTGGAAAGATCCAAAATTGTATGACATTTCTTTTTATGATATACCATTT
JMSF029O07+ TAAAAAGGATGTTGGAAAGATCCAAAATTGTATGACATTTCTTTTTATGATATACCATTT
                      ____________________________________________________________
consensus TAAAAAGGATGTTGGAAAGATCCAAAATTGTATGACATTTCTTTTTATGATATACCATTT
 
. : . : . : . : . : . :
JMFS168H03+ TCCTTCTGATCTACACAGTATTTGAATCCAGCTACTTCATAGGATTAATTTTCAACCAAT
JMFS152D08+ GATCTACACAGTATTT-AATCCAGCTACTTCATAGGATTAATTTTCAACCAAT
JMFF017K15+ TCCTTCTGATCTACACAGTATTTGAATCCAGCTACTTCATAGGATTAATTTTCAACCAAT
JMSF029O07+ TCCTTCTGATCTACACAGTATTTGAATCCAGCTACTTCATAGGATTAATTTTCAACCAAT
                      ____________________________________________________________
consensus TCCTTCTGATCTACACAGTATTTGAATCCAGCTACTTCATAGGATTAATTTTCAACCAAT
 
. : . : . : . : . : . :
JMFS168H03+ ATCACCAACTACAACAATTACTGACTAGAAAGTCACCCAAGCTGAGCGAACTGTGATTAG
JMFS152D08+ ATCACCAACTACAACAATTACTGACTAGAAAGTCACCCAAGCTGAGCGAACTGTGATTAG
JMFF017K15+ ATCACCAACTACAACAATTACTGACTAGAAAGTCACCCAAGCTGAGCGAACTGTGATTAG
JMSF029O07+ ATCACCAACTACAACAATTACTGACTAGAAAGTCACCCAAGCTGAGCGAACTGTGATTAG
                      ____________________________________________________________
consensus ATCACCAACTACAACAATTACTGACTAGAAAGTCACCCAAGCTGAGCGAACTGTGATTAG
 
. : . : . : . : . : . :
JMFS168H03+ CACCAAGTAACTTAAGAGGCCACTGCTAAACACTCTTTTGCCAATGCTTCAACAATACAC
JMFS152D08+ CACCAAGTAACTTAAGAGGCCACTGCTAAACACTCTTTTGCCAATGCTTCAACAATACAC
JMFF017K15+ CACCAAGTAACTTAAGAGGCCACTGCTAAACACTCTTTTGCCAATGCTTCAACAATACAC
JMSF029O07+ CACCAAGTAACTTAAGAGGCCACTGCTAAACACTCTTTTGCCAATGCTTCAACAATACAC
                      ____________________________________________________________
consensus CACCAAGTAACTTAAGAGGCCACTGCTAAACACTCTTTTGCCAATGCTTCAACAATACAC
 
. : . : . : . : . : . :
JMFS168H03+ TTATATATGAGTGAGTCCAATCAGATTCCAGCCAGTATCTTCCAAGAAAAAGTACACCAG
JMFS152D08+ TTATATATGAGTGAGTCCAATCAGATTCCAGCCAGTATCTTCCAAGAAAAAGTACACCAG
JMFF017K15+ TTATATATGAGTGAGTCCAATCAGATTCCAGCCAGTATCTTCCAAGAAAAAGTACACCAG
JMSF029O07+ TTATATATGAGTGAGTCCAATCAGATTCCAGCCAGTATCTTCCAAGAAAAAGTACACCAG
                      ____________________________________________________________
consensus TTATATATGAGTGAGTCCAATCAGATTCCAGCCAGTATCTTCCAAGAAAAAGTACACCAG
 
. : . : . : . : . : . :
JMFS168H03+ TGTCCAATGGAGCTTAGTCACAGTGAAGATCAGACCATTCAGAAAATATGATAAAGCAAT
JMFS152D08+ TGTCCAATGGAGCTTAGTCACAGTGAAGATCAGACCATTCAGAAAATATGATAAAGCAAT
JMFF017K15+ TGTCCAATGGAGCTTAGTCACAGTGAAGATCAGACCATTCAGAAAATATGATAAAGCAAT
JMSF029O07+ TGTCCAATGGAGCTTAGTCACAGTGAAGATCAGACCATTCAGAAAATATGATAAAGCAAT
                      ____________________________________________________________
consensus TGTCCAATGGAGCTTAGTCACAGTGAAGATCAGACCATTCAGAAAATATGATAAAGCAAT
 
. : . : . : . : . : . :
JMFS168H03+ ACTGCATATATGATATATGTGATTCACATGTATTCACAAATAGTATCTTCTGCCTCTGTG
JMFS152D08+ ACTGCATATATGATATATGTGATTCACATGTATTCACAAATAGTATCTTCTGCCTCTGTG
JMFF017K15+ ACTGCATATATGATATATGTGATTCACATGTATTCACAAATAGTATCTTCTGCCTCTGTG
JMSF029O07+ ACTGCATATATGATATATGTGATTCACATGTATTCACAAATAGTATCTTCTGCCTCTGTG
                      ____________________________________________________________
consensus ACTGCATATATGATATATGTGATTCACATGTATTCACAAATAGTATCTTCTGCCTCTGTG
 
. : . : . : . : . : . :
JMFS168H03+ TGTGTTTGTACTGCGGAGAATACTAAATAGGTATAGATAGATCGTTAGATAGATGTTGAG
JMFS152D08+ TGTGTTTGTACTGCGGAGAATACTAAATAGGTATAGATAGATCGTTAGATAGATGTTGAG
JMFF017K15+ TGTGTTTGTACTGCGGAGAATACTAAATAGGTATAGATAGATCGTTAGATAGATGTTGAG
JMSF029O07+ TGTGTTTGTACTGCGGAGAATACTAAATAGGTATAGATAGATCGTTAGATAGATGTTGAG
                      ____________________________________________________________
consensus TGTGTTTGTACTGCGGAGAATACTAAATAGGTATAGATAGATCGTTAGATAGATGTTGAG
 
. : . : . : . : . : . :
JMFS168H03+ TGGATTTGTACGTAGCTCAAGCAATCGGAGTACGGAATAGAGTACGGTATGGAGTACGGA
JMFS152D08+ TGGATTTGTACGTAGCTCAAGCAATCGGAGTACGGAATAGAGTACGGTATGGAGTACGGA
JMFF017K15+ TGGATTTGTACGTAGCTCAAGCAATCGGAGTACGGAATAGAGTACGGTATGGAGTACGGA
JMSF029O07+ TGGATTTGTACGTAGCTCAAGCAATCGGAGTACGGAATAGAGTACGGTATGGAGTACGGA
                      ____________________________________________________________
consensus TGGATTTGTACGTAGCTCAAGCAATCGGAGTACGGAATAGAGTACGGTATGGAGTACGGA
 
. : . : . : . : . : . :
JMFS168H03+ CCTAGGGTTTCGAGACCAGAGAAAACGCTAA
JMFS152D08+ CCTAGGGTTTC
JMFF017K15+ CCTAGGGTTTCGAGACCAGAGAAAACGCTAAATAAAGGACTTCGATATGAGCTGAAA
JMSF029O07+ CCTAGGGTTTCGAGACCAGAGAAAACGCTAAATAAAGGACTTCGATATGAGCTGAAATTC
                      ____________________________________________________________
consensus CCTAGGGTTTCGAGACCAGAGAAAACGCTAAATAAAGGACTTCGATATGAGCTGAAATTC