Previous Contig 006617:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029N07Sequence607006617 (2)gb:OSJN00292_16980722e-20Oryza sativa genomic DNA, chromosome 4, BAC clone: P0076O17, complete sequence.749011816 (36)gb:ATAC002343_15427849e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF036N13Sequence660006617 (2)sp|Q8L7G0|ARFA_ARATH1e-43Auxin response factor 1.>pir|D96621|D96621 auxin response factor 1 [imported] - 750011816 (36)pir|A84904|A849046e-28hypothetical protein At2g46530 [imported] - Arabidopsis thaliana>gb:AC006418_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036N13+ TCCATGAGTACTAGTATCCGATGCCGTTAGAATNTTACAAAACG
                      ____________________________________________________________
consensus TCCATGAGTACTAGTATCCGATGCCGTTAGAATNTTACAAAACG
 
. : . : . : . : . : . :
JMSF036N13+ AGTGAACAATCCGCTTAGGTGGATCAGGGATGCATTCATCAGGACTGGTGGGCTCGGTTT
                      ____________________________________________________________
consensus AGTGAACAATCCGCTTAGGTGGATCAGGGATGCATTCATCAGGACTGGTGGGCTCGGTTT
 
. : . : . : . : . : . :
JMSF036N13+ GATCCGCCTCTGGGAGTAAAGTGATCTGTGCATAGACTTCATCATTCTCCGCTTCTGCCA
JMSF029N07+ TCTGCCA
                      ____________________________________________________________
consensus GATCCGCCTCTGGGAGTAAAGTGATCTGTGCATAGACTTCATCATTCTCCGCTTCTGCCA
 
. : . : . : . : . : . :
JMSF036N13+ ATAATTGAAGATTCACAACTCGACAAAGTATCTTCGAAGGAAGACCAAACTGAGGAATCT
JMSF029N07+ ATAATTGAAGANTCACAACTCGACAAAGTATCTTCGAAGGAAGACCAAACTGAGGAATCT
                      ____________________________________________________________
consensus ATAATTGAAGATTCACAACTCGACAAAGTATCTTCGAAGGAAGACCAAACTGAGGAATCT
 
. : . : . : . : . : . :
JMSF036N13+ GTTGAGTCAAAGCCTGGTTTGTAGACACCTCTAATTGTTCTATGTGACCCTGGGGAAAGT
JMSF029N07+ GTTGAGTCAAAGCCTGGTTTGTAGACACCTCTAATTGTTCTATGTGACCCTGGGGAAAGT
                      ____________________________________________________________
consensus GTTGAGTCAAAGCCTGGTTTGTAGACACCTCTAATTGTTCTATGTGACCCTGGGGAAAGT
 
. : . : . : . : . : . :
JMSF036N13+ AGTAAGCCCTCTCTCCTTCTTTAGGAACATCTACCAAAGGCCCTGCACATGACTTCCATA
JMSF029N07+ AGTAAGCCCTCTCTCCTTCTTTAGGAACATCTACCAAAGGCCCTGCACATGACTTCCATA
                      ____________________________________________________________
consensus AGTAAGCCCTCTCTCCTTCTTTAGGAACATCTACCAAAGGCCCTGCACATGACTTCCATA
 
. : . : . : . : . : . :
JMSF036N13+ GCTCTGGTGACAGATCATCACATCCCAAGCCTGAAATTTGTCTCTGCACCCCATGAGAAA
JMSF029N07+ GCTCTGGNGACAGATCATCACATCCCAAGCNTGAAATTTGTCTCTGCACCCCATGAGAAA
                      ____________________________________________________________
consensus GCTCTGGTGACAGATCATCACATCCCAAGCCTGAAATTTGTCTCTGCACCCCATGAGAAA
 
. : . : . : . : . : . :
JMSF036N13+ CTCCTCCTCTAATACCCACATCCACATGAGCCATTCAAGCTCAGAAAAAAAATACACAAA
JMSF029N07+ CTCCTCCTCTAATACCCACATCCACATGAGCCATTCAAGCTCAGAAAAAAAATACACAAA
                      ____________________________________________________________
consensus CTCCTCCTCTAATACCCACATCCACATGAGCCATTCAAGCTCAGAAAAAAAATACACAAA
 
. : . : . : . : . : . :
JMSF036N13+ AAGACTCCCACCTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAACAAA
JMSF029N07+ AAGACTCCCACCTTTTTTCAGTTACAAAACCACTCTCGGNTGTGTNTTNTCAGCAACAAA
                      ____________________________________________________________
consensus AAGACTCCCACCTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAACAAA
 
. : . : . : . : . : . :
JMSF036N13+ ACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTTCGT
JMSF029N07+ ACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTTCGT
                      ____________________________________________________________
consensus ACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTTCGT
 
. : . : . : . : . : . :
JMSF036N13+ GTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAATCCCAAAACCGCTT
JMSF029N07+ GTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAATCCCAAAACCGCTT
                      ____________________________________________________________
consensus GTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAATCCCAAAACCGCTT
 
. : . : . : . : . : . :
JMSF036N13+ CTCACACATACACTC
JMSF029N07+ CTCACACATACACTCGCTCTCTCTGTNTATAGAAAGACCATAAATCTCTGTCTCTCCCTC
                      ____________________________________________________________
consensus CTCACACATACACTCGCTCTCTCTGTNTATAGAAAGACCATAAATCTCTGTCTCTCCCTC
 
. : . : . : . : . : . :
JMSF029N07+ TGTCCATGGGGACACCAAATTTTCTCTCTGTCTCTCTCTCTCTCTCTCTCTCTCTCTTTC
                      ____________________________________________________________
consensus TGTCCATGGGGACACCAAATTTTCTCTCTGTCTCTCTCTCTCTCTCTCTCTCTCTCTTTC