Previous Contig 006613:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029L11Sequence584006613 (2)gb:AY389648_11782724e-39Hyacinthus orientalis histone H4 mRNA, complete cds.535006613 (2)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029L11+ TCAGATTTCCTTAGCTTAGAA
JMSF029L11- CGGCAATCAAAAATCTTCGAAGTTCAGATTTCCTTAGCTTAGAA
                      ____________________________________________________________
consensus CGGCAATCAAAAATCTTCGAAGTTCAGATTTCCTTAGCTTAGAA
 
. : . : . : . : . : . :
rJMSF029L11+ GAGAAGTACTTTCTGAAGATGTCTGGGCGTGGAAAGGGCGGTAAGGGTTTGGGAAAGGGA
JMSF029L11- GAGAAGTACTTTCTGAAGATGTCTGGGCGTGGAAAGGGCGGTAAGGGTTTGGGAAAGGGA
                      ____________________________________________________________
consensus GAGAAGTACTTTCTGAAGATGTCTGGGCGTGGAAAGGGCGGTAAGGGTTTGGGAAAGGGA
 
. : . : . : . : . : . :
rJMSF029L11+ GGAGCGAAACGACACCGTAAGGTCCTCCGGGACAACATCCAAGGCATCACGAAGCCGGCC
JMSF029L11- GGAGCGAAACGACACCGTAAGGTCCTCCGGGACAACATCCAAGGCATCACGAAGCCGGCC
                      ____________________________________________________________
consensus GGAGCGAAACGACACCGTAAGGTCCTCCGGGACAACATCCAAGGCATCACGAAGCCGGCC
 
. : . : . : . : . : . :
rJMSF029L11+ ATTCGCCGTCTGGCTCGCCGTGGTGGAGTGAAGCGTATCTCCGGTCTCATCTACGAGGAG
JMSF029L11- ATTCGCCGTCTGGCTCGCCGTGGTGGAGTGAAGCGTATCTCCGGTCTCATCTACGAGGAG
                      ____________________________________________________________
consensus ATTCGCCGTCTGGCTCGCCGTGGTGGAGTGAAGCGTATCTCCGGTCTCATCTACGAGGAG
 
. : . : . : . : . : . :
rJMSF029L11+ ACTCGCGGCGTCCTCAAGATCTTCCTTGAGAATGTCATCCGCGATGCTGTTACCTACACC
JMSF029L11- ACTCGCGGCGTCCTCAAGATCTTCCTTGAGAATGTCATCCGCGATGCTGTTACCTACACC
                      ____________________________________________________________
consensus ACTCGCGGCGTCCTCAAGATCTTCCTTGAGAATGTCATCCGCGATGCTGTTACCTACACC
 
. : . : . : . : . : . :
rJMSF029L11+ GAGCACGCTCGCCGGAAGACGGTCACCGCAATGGACGTCGTCTATGCTCTCAAGAGACAG
JMSF029L11- GAGCACGCTCGCCGGAAGACGGTCACCGCAATGGACGTCGTCTATGCTCTCAAGAGACAG
                      ____________________________________________________________
consensus GAGCACGCTCGCCGGAAGACGGTCACCGCAATGGACGTCGTCTATGCTCTCAAGAGACAG
 
. : . : . : . : . : . :
rJMSF029L11+ GGCCGCACCCTGTACGGATTCGGCGGTTAGCTTTTCTTATCGGCGGTGTATATTTTGGTG
JMSF029L11- GGCCGCACCCTGTACGGATTCGGCGGTTAGCTTTTCTTATCGGCGGTGTATATTTTGGTG
                      ____________________________________________________________
consensus GGCCGCACCCTGTACGGATTCGGCGGTTAGCTTTTCTTATCGGCGGTGTATATTTTGGTG
 
. : . : . : . : . : . :
JMSF029L11- TTCTATTCTGAATCAATCTCAGATTTATTGTGACAATGTTACTCTGATTTCAATTCAATG
                      ____________________________________________________________
consensus TTCTATTCTGAATCAATCTCAGATTTATTGTGACAATGTTACTCTGATTTCAATTCAATG
 
. : . : . : . : . : . :
JMSF029L11- AATTTCAGTTCTTATGAATTCTCAATTTTCTTAATTTTATATCTTCTATTTGACTCTTCG
                      ____________________________________________________________
consensus AATTTCAGTTCTTATGAATTCTCAATTTTCTTAATTTTATATCTTCTATTTGACTCTTCG
 
. : . : . : . : . : . :
JMSF029L11- TTGCAATTCGTAATATTTGTAAAATGGTTTATGAAAAGTTTGTTCAAAGGAAAAAAAAAA
                      ____________________________________________________________
consensus TTGCAATTCGTAATATTTGTAAAATGGTTTATGAAAAGTTTGTTCAAAGGAAAAAAAAAA