Previous Contig 006612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028O22Sequence482006612 (5)gb:AB026647_15172124e-25Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.>gb:AY057704_156612006612 (5)pir|T07174|T071741e-18tuberisation-related protein - potato>gb:STAJ3219_1722705 Solanum tuberosum mRNA
JMSF029L07Sequence654006612 (5)gb:AY088240_15732618e-39Arabidopsis thaliana clone 4642 mRNA, complete sequence.714006612 (5)pir|T07174|T071742e-30tuberisation-related protein - potato>gb:STAJ3219_1722705 Solanum tuberosum mRNA
JMSF043I09Sequence805006612 (5)gb:AY088240_15732611e-38Arabidopsis thaliana clone 4642 mRNA, complete sequence.763002871 (5)gb:AP004300_18397981e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028O22- TT
                      ____________________________________________________________
consensus TT
 
. : . : . : . : . : . :
rJMFF028O22- TAATTAGTATAATAGCCATGGCTGACAAGATCTTGTATAACACGTACAACAA-GTTAGAA
rJMSF029L07- ACGTACAACAAGGTTAGAA
                      ____________________________________________________________
consensus TAATTAGTATAATAGCCATGGCTGACAAGATCTTGTATAACACGTACAACAAGGTTAGAA
 
. : . : . : . : . : . :
rJMFF028O22- CCTCAACTCCATTACAAGATTCCGATCACAGCACTGTGAATGTTCTAAATTTTTTTCTAA
rJMSF029L07- CCTCAACTCCATTACAAGATTCCGATCACAGCACTGTGAATGTTCTAAATTTTTTTCTAA
                      ____________________________________________________________
consensus CCTCAACTCCATTACAAGATTCCGATCACAGCACTGTGAATGTTCTAAATTTTTTTCTAA
 
. : . : . : . : . : . :
rJMFF028O22- AAAATGAAAAAGTTTTGATCTTGAAAATTTATTATAATAACACAGCAGAATTATCGTCTA
rJMSF029L07- AAAATGAAAAAGTTTTGATCTTGAAAATTTATTATAATAACACAGCAGAATTATCGTCTA
                      ____________________________________________________________
consensus AAAATGAAAAAGTTTTGATCTTGAAAATTTATTATAATAACACAGCAGAATTATCGTCTA
 
. : . : . : . : . : . :
rJMFF028O22- AATCAAAGCACTAATCCAAAAATTCCGACAACTGTAAAGAATGCGTGTAGATTCATGTTA
rJMSF029L07- AATCAAAGCACTAATCCAAAAATTCCGACAACTGTAAAGAATGCGTGTAGATTCATGTTA
JMSF043I09+ AAAGAATGCGTGTAGATTCATGTTA
                      ____________________________________________________________
consensus AATCAAAGCACTAATCCAAAAATTCCGACAACTGTAAAGAATGCGTGTAGATTCATGTTA
 
. : . : . : . : . : . :
rJMFF028O22- CTTTTCCAGTTTCTGGAAGCGCCGCCGGCGTCGTTGCCGGTGGTCTGCCCGGAAGCAGGG
rJMSF029L07- CTTTTCCAGTTTCTGGAAGCGCCGCCGGCGTCGTTGCCGGTGGTCTGCCCGGAAGCAGGG
JMSF043I09+ CTTTTCCAGTTTCTGGAAGCGCCGCCGGCGTCGTTGCCGGTGGTCTGCCCGGAAGCAGGG
                      ____________________________________________________________
consensus CTTTTCCAGTTTCTGGAAGCGCCGCCGGCGTCGTTGCCGGTGGTCTGCCCGGAAGCAGGG
 
. : . : . : . : . : . :
rJMFF028O22- GAGATCGCAGTCTTTTTGCCGTCGCCGCCGGGGGCGGCGGCGGTGGGTGCCGGAGAAGGA
rJMSF029L07- GAGATCGCAGTCTTTTTGCCGTCGCCGCCGGGGGCGGCGGCGGTGGGTGCCGGAGAAGGA
JMSF043I09+ GAGATCGCAGTCTTTTTGCCGTCGCCGCCGGGGGCGGCGGCGGTGGGTGCCGGAGAAGGA
                      ____________________________________________________________
consensus GAGATCGCAGTCTTTTTGCCGTCGCCGCCGGGGGCGGCGGCGGTGGGTGCCGGAGAAGGA
 
. : . : . : . : . : . :
rJMFF028O22- GCCTTGGAGATGGTGTTTCCGGCCGCCGTCAGGTCCAATGTGGATTTAGCGTCGAGATTT
rJMSF029L07- GCCTTGGAGATGGTGTTTCCGGCCGCCGTCAGGTCCAATGTGGATTTAGCGTCGAGATTT
JMSF043I09+ GCCTTGGAGATGGTGTTTCCGGCCGCCGTCAGGTCCAATGTGGATTTAGCGTCGAGATTT
JMSF029L07+ GAGATGGTGTTTCCGGCCGCCGTCAGGTCCAATGTGGATTTAGCGTCGAGATTT
                      ____________________________________________________________
consensus GCCTTGGAGATGGTGTTTCCGGCCGCCGTCAGGTCCAATGTGGATTTAGCGTCGAGATTT
 
. : . : . : . : . : . :
rJMFF028O22- TCCTGACTCATTTGGTGCTTCTGCGGCACTCCGTCCTTGACGGACGCGCCCACCTGCCAA
rJMSF029L07- TCCTGACTCATTTGGTGCTTCTGCGGCACTCCGTCCTTGACGGACGCGCCCACCTGCCAA
JMSF043I09+ TCCTGACTCATTTGGTGCTTCTGCGGCACTCCGTCCTTGACGGACGCGCCCACCTGCCAA
JMSF029L07+ TCCTGACTCATTTGGTGCTTCTGCGGCACTCCGTCCTTGACGGACGCGCCCACCTGCCAA
                      ____________________________________________________________
consensus TCCTGACTCATTTGGTGCTTCTGCGGCACTCCGTCCTTGACGGACGCGCCCACCTGCCAA
 
. : . : . : . : . : . :
rJMFF028O22- ACATGGTTCACCGTCGCCATTTTTTCCGGCAGCTCCACGGTGGCGAAAATTCTCATCACC
rJMSF029L07- ACATGGTTCACCGTCGCCATTTTTTCCGGCAGCTCCACGGTGGCGAAAATTCTCATCACC
JMSF043I09+ ACATGGTTCACCGTCGCCATTTTTTCCGGCAGCTCCACGGTGGCGAAAATTCTCATCACC
JMFF028O22+ TCATCACC
JMSF029L07+ ACATGGTTCACCGTCGCCATTTTTTCCGGCAGCTCCACGGTGGCGAAAATTCTCATCACC
                      ____________________________________________________________
consensus ACATGGTTCACCGTCGCCATTTTTTCCGGCAGCTCCACGGTGGCGAAAATTCTCATCACC
 
. : . : . : . : . : . :
rJMFF028O22- CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
rJMSF029L07- CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
JMSF043I09+ CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
JMFF028O22+ CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
JMSF029L07+ CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
                      ____________________________________________________________
consensus CCGTCCGCCGCCGCCTCCGCCCGGGAGTCCAGCACCTTCAGGGAGAGCTTCTGCGGGGTT
 
. : . : . : . : . : . :
rJMFF028O22- ATGCCGCCGTA
rJMSF029L07- ATGCCGCCGTAGGAGGTGAGATTGTAAGTTTTCACGGCGACTTTGCCCTGTGGGTCCTTG
JMSF043I09+ ATGCCGCCGTAGGAGGTGAGATTGTAAGTTTTCACGGCGACTTTGCCCTGTGGGTCCTTG
JMFF028O22+ ATGCCGCCGTAGGAGGTGAGATTGTAAGTTTTCACGGCGACTTTGCCCTGTGGGTCCTTG
JMSF029L07+ ATGCCGCCGTAGGAGGTGAGATTGTAAGTTTTCACGGCGACTTTGCCCTGTGGGTCCTTG
                      ____________________________________________________________
consensus ATGCCGCCGTAGGAGGTGAGATTGTAAGTTTTCACGGCGACTTTGCCCTGTGGGTCCTTG
 
. : . : . : . : . : . :
rJMSF029L07- AAGGCGATGAAGGCCTGCGTGCCGATCATGCCGGTGGCGGTGGGGTTAATGCCCCAGGCG
JMSF043I09+ AAGGCGATGAAGGCCTGCGTGCCGATCATGCCGGTGGCGGTGGGGTTAATGCCCCAGGCG
JMFF028O22+ AAGGCGATGAAGGCCTGCGTGCCGATCATGCCGGT-GCGGTGGGGTTAATGCCCCAGGCG
JMSF029L07+ AAGGCGATGAAGGCCTGCGTGCCGATCATGCCGGTGGCGGTGGGGTTAATGCCCCAGGCG
                      ____________________________________________________________
consensus AAGGCGATGAAGGCCTGCGTGCCGATCATGCCGGTGGCGGTGGGGTTAATGCCCCAGGCG
 
. : . : . : . : . : . :
rJMSF029L07- ATCCACCCGTCGGCGGCGGCCGGCGGCGCCACGAA
JMSF043I09+ ATCCACCCGTCGGCGGCGGCCGGCGGCGCCACGAAGGCGACGGAGAGGGTGGATTTCGTC
JMFF028O22+ ATCCACCCGTCGGCGGCGGCCGGCGGCGCCACGAAGGCGACGGAGAGGGTGGATTTCGTC
JMSF029L07+ ATCCACCCGTCGGCGGCGGCCGGCGGCGCCACGAAGGCGACGGAGAGGGTGGATTTCGTC
                      ____________________________________________________________
consensus ATCCACCCGTCGGCGGCGGCCGGCGGCGCCACGAAGGCGACGGAGAGGGTGGATTTCGTC
 
. : . : . : . : . : . :
JMSF043I09+ TGGTTATATGTCCAGTGGAGGAAAGCCTTGAGGGTGGGGAGGTCGGAGCAGTTGGCGTAG
JMFF028O22+ TGGTTATATGTCCAGTGGAGGAAAGCCTTGAGGGTGGGGAGGTCGGAGCAGTTGGCGTAG
JMSF029L07+ TGGTTATATGTCCAGTGGAGGAAAGCCTTGAGGGTGGGGAGGTCGGAGCAGTTGGCGTAG
                      ____________________________________________________________
consensus TGGTTATATGTCCAGTGGAGGAAAGCCTTGAGGGTGGGGAGGTCGGAGCAGTTGGCGTAG
 
. : . : . : . : . : . :
JMSF043I09+ TGAGCTTTCGTCGAGAAAGTCTGCGACGTGCACTGTAGCGACACCGCCGGCGAGATTAGC
JMFF028O22+ TGAGCTTTCGTCGAGAAAGTCTGCGACGTGCACTGTAGCGACACCGCCGGCGAGATTAGC
JMSF029L07+ TGAGCTTTCGTCGAGAAAGTCTGCGACGTGCACTGTAGCGACACCGCCGGCGAGATTAGC
                      ____________________________________________________________
consensus TGAGCTTTCGTCGAGAAAGTCTGCGACGTGCACTGTAGCGACACCGCCGGCGAGATTAGC
 
. : . : . : . : . : . :
JMSF043I09+ AGAGCTCCGAGGAGGAGGAGGAGGCTGAGGAGGGGAGAAAAGGAGGACATTGTGCGTTTT
JMFF028O22+ AGAGCTCCGAGGAGGAGGAGGAGGCTGAGGAGGGGAGAAAAGGAGGACATTGTGCG-TTT
JMSF029L07+ AGAGCTCCGAGGAGGAGGAGGAGGCTGAGGAGGGGAGAAAAGGAGGACATTGTGCGTTTT
                      ____________________________________________________________
consensus AGAGCTCCGAGGAGGAGGAGGAGGCTGAGGAGGGGAGAAAAGGAGGACATTGTGCGTTTT
 
. : . : . : . : . : . :
JMSF043I09+ GCGACGCCGCAGGCGGTGGCTGACAACGGCCGTGTAGGTGGCGGTGTAGATAATAT
JMFF028O22+ GCGACGCCGCAGGCGGTGGCTGACAACGGCCGTGTAGGTGGCGGTGTAGATAATAT
JMSF029L07+ GCGACGCCGCAGGCGGTGGCTGACAACGGCCGTGTAGGTGGCGGTGTAGATAATATGACC
                      ____________________________________________________________
consensus GCGACGCCGCAGGCGGTGGCTGACAACGGCCGTGTAGGTGGCGGTGTAGATAATATGACC