Previous Contig 006604:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020L02Sequence797006604 (4)gb:AP003407_18289192e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107
JMFN007H23Sequence585006604 (4)gb:AP003407_18289199e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107
JMSF029J13Sequence666006604 (4)gb:AP003407_18289192e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107756006604 (4)gb:AP003407_18289192e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007H23+ AGTCTTTCATATTAACCACCATAACCTTT
rJMFF020L02- GTCTTTCATATTAACCACCATAACCTTT
                      ____________________________________________________________
consensus AGTCTTTCATATTAACCACCATAACCTTT
 
. : . : . : . : . : . :
JMFN007H23+ TGTCAATCCACAGTTAATCATCACAT-GTAAGTTTATCCTCAAAACCAAACAAAGAATAT
rJMFF020L02- TGTCATTCCACAGTTAATCATCACAT-GTAAGTTTATCCTCAAAACCAAACAAAGAATAT
rJMSF029J13- ATCATCACATGGTAAGTTTATCCTCAAAACCAAACAAAGAATAT
                      ____________________________________________________________
consensus TGTCATTCCACAGTTAATCATCACAT-GTAAGTTTATCCTCAAAACCAAACAAAGAATAT
 
. : . : . : . : . : . :
JMFN007H23+ CCCTATCCCTATCTCTATCCTACCAACAAAAAGCTTGATATTGAATGCAAAATATGAAAA
rJMFF020L02- CCCTATCCCTATCCCTATCCTACCAACAAAAAGCTTGATATTGAATGCAAAATATGAAAA
rJMSF029J13- CCCTATCCCTATCCCTATCCTACCAACAAAAAGCTTGATATTGAATGCAAAATATGAAAA
                      ____________________________________________________________
consensus CCCTATCCCTATCCCTATCCTACCAACAAAAAGCTTGATATTGAATGCAAAATATGAAAA
 
. : . : . : . : . : . :
JMFN007H23+ GGCTGGATTCTACTTTCTGGAGCTAAAAGCTCCAAAATTGTGTATGATTATTGCACTCTC
rJMFF020L02- GGCTGGATTCTACTTTCTGGAGCTAAAAGCTCCAAAATTGTGTATGATTATTGCACTCTC
rJMSF029J13- GGCTGGATTCTACTTTCTGGAGCTAAAAGCTCCAAAATTGTGTATGATTATTGCACTCTC
                      ____________________________________________________________
consensus GGCTGGATTCTACTTTCTGGAGCTAAAAGCTCCAAAATTGTGTATGATTATTGCACTCTC
 
. : . : . : . : . : . :
JMFN007H23+ TGGAGCAGCTTCTCCACCATAATCTTCTGCTGCACGGCGCTCAAAGACTCGGAATTCATG
rJMFF020L02- TGGAGCAGCTTCTCCACCATAATCTTCTGCTGCACGGCGCTCAAAGACTCGGAATTCATG
rJMSF029J13- TGGAGCAGCTTCTCCACCATAATCTTCTGCTGCACGGCGCTCAAAGACTCGGAATTCATG
                      ____________________________________________________________
consensus TGGAGCAGCTTCTCCACCATAATCTTCTGCTGCACGGCGCTCAAAGACTCGGAATTCATG
 
. : . : . : . : . : . :
JMFN007H23+ ATAGCATTTGCGACAAGGATAGTTGTTGCAGGGGCGGGAACATTTACCCAATTACGCCCA
rJMFF020L02- ATAGCATTTGCGACAAGGATAGTTGTTGCAGGGGCGGGAGCATTTACCCAATTACGCCCA
rJMSF029J13- ATAGCATTTGCGACAAGGATAGTTGTTGCAGGGGCGGGAGCATTTACCCAATTACGCCCA
                      ____________________________________________________________
consensus ATAGCATTTGCGACAAGGATAGTTGTTGCAGGGGCGGGAGCATTTACCCAATTACGCCCA
 
. : . : . : . : . : . :
JMFN007H23+ TTCAAACCAATTGCAATTTCAAAAGAGAGCTTCTTGCCAAGAGCTTCAAGAACAGGGCAT
rJMFF020L02- TTCAAACCAATTGCAATTTCAAAAGAGAGCTTCTTGCCAAGAGCTTCAAGAACAGGGCAT
rJMSF029J13- TTCAAACCAATTGCAATTTCAAAAGAGAGCTTCTTGCCAAGAGCTTCAAGAACAGGGCAT
                      ____________________________________________________________
consensus TTCAAACCAATTGCAATTTCAAAAGAGAGCTTCTTGCCAAGAGCTTCAAGAACAGGGCAT
 
. : . : . : . : . : . :
JMFN007H23+ GTTGGGGAACTCAAAAGTATCCGTGATAAGCCTGTTGATGATTCAAACATGTAACCCTCT
rJMFF020L02- GTCGGGGAACTCAAAAGTATCCGTGATAAGCCTGTTGATGATTCAAACATGTAACCCTCT
rJMSF029J13- GTCGGGGAACTCAAAAGTATCCGTGATAAGCCTGTTGATGATTCAAACATGTAACCCTCT
                      ____________________________________________________________
consensus GTCGGGGAACTCAAAAGTATCCGTGATAAGCCTGTTGATGATTCAAACATGTAACCCTCT
 
. : . : . : . : . : . :
JMFN007H23+ TTAAGGGGACCAAACTCAGAAGCCTTTCCTGAAGCATCCATGCATGACAGCTCAGGGTTC
rJMFF020L02- TTAAGGGGACCAAACTCAGAAGCCTTTCCTGAAGCATCCATGCATGACAGCTCAGGGTTC
rJMSF029J13- TTAAGGGGACCAAACTCAGAAGCCTTTCCTGAAGCATCCATGCATGACAGCTCAGGGTTC
                      ____________________________________________________________
consensus TTAAGGGGACCAAACTCAGAAGCCTTTCCTGAAGCATCCATGCATGACAGCTCAGGGTTC
 
. : . : . : . : . : . :
JMFN007H23+ ATTCCAGTGTTGGCCTTGTCAACACGAGCATAAATCAGCGTTCCAGCCTCAAATTTTGGA
rJMFF020L02- ATTCCAGTGTTGGCCTTGACAACACGAGCATAAATCAGCGTTCCAGCCTCAAATTTTGGA
rJMSF029J13- ATTCCAGTGTTGGCCTTGACAACACGAGCATAAATCAGCGTTCCAGCCTCAAATTTTGGA
JMSF029J13+ TTTGGA
                      ____________________________________________________________
consensus ATTCCAGTGTTGGCCTTGACAACACGAGCATAAATCAGCGTTCCAGCCTCAAATTTTGGA
 
. : . : . : . : . : . :
JMFN007H23+ ATGTTTCTTCTCGTTCC
rJMFF020L02- ATGTTTCTTCTCGTTCCTCCTTCAAATGCTAGAACGGGCAAAAATGCCAACATTGACCCT
rJMSF029J13- ATGTTTCTTCTCGTTCCTCCTTCAAATGCTAGAACGGGCAAAAATGCCAACATTGACCCT
JMSF029J13+ ATGTTTCTTCTCGTTCCTCCTTCAAATGCTAGAACGGGCAAAAATGCCAACATTGACCCT
                      ____________________________________________________________
consensus ATGTTTCTTCTCGTTCCTCCTTCAAATGCTAGAACGGGCAAAAATGCCAACATTGACCCT
 
. : . : . : . : . : . :
rJMFF020L02- TTAATGTCTACAAGAAAGTTATCTGGTTTAGTGTCGACCACGATTCCAAGAACTGAATCT
rJMSF029J13- TTAATGTCTACAAGAAAGTTATCTGGTTTAGTGTCGACCACGATTCCAAGAACTGAATCT
JMSF029J13+ TTAATGTCTACAAGAAAGTTATCTGGTTTAGTGTCGACCACGATTCCAAGAACTGAATCT
                      ____________________________________________________________
consensus TTAATGTCTACAAGAAAGTTATCTGGTTTAGTGTCGACCACGATTCCAAGAACTGAATCT
 
. : . : . : . : . : . :
rJMFF020L02- CCCGCACTAGGAACATATCTTTTTTGTGAGCTTTCAACCCAGTATTTATTTGGCTTTGTA
rJMSF029J13- CCCGCACTAGGAACATATCTTTTTTGTGAGCTTTCAACCCAGTATTTATTTGGCTTTGTA
JMSF029J13+ CCCGCACTAGGAACATATCTTTTTTGTGAGCTTTCAACCCAGTATTTATTTGGCTTTGTA
                      ____________________________________________________________
consensus CCCGCACTAGGAACATATCTTTTTTGTGAGCTTTCAACCCAGTATTTATTTGGCTTTGTA
 
. : . : . : . : . : . :
rJMFF020L02- TATCTCAAAATCCCAGCTTTCATGACAGATACAGTATCACAATCCTGTCG
rJMSF029J13- TATCTCAAAATCCCAGCTTTCATGACAGATACAGTATCACAATCCTGTCG
JMSF029J13+ TATCTCAAAATCCCAGCTTTCATGACAGATACAGTATCACAATCCTGTCGAAGGCCACCC
                      ____________________________________________________________
consensus TATCTCAAAATCCCAGCTTTCATGACAGATACAGTATCACAATCCTGTCGAAGGCCACCC
 
. : . : . : . : . : . :
JMSF029J13+ CCAAGCTTTATGGTTTCGTTAGCCAGTGAAGAAAGATCCAATATCACATCACCTGGGACT
                      ____________________________________________________________
consensus CCAAGCTTTATGGTTTCGTTAGCCAGTGAAGAAAGATCCAATATCACATCACCTGGGACT
 
. : . : . : . : . : . :
JMSF029J13+ ACTGGTTGGTCGATGAAGCTTGAGAGAGTATTTGGTTGTTTAGCTTCCATTTTCATTTTT
                      ____________________________________________________________
consensus ACTGGTTGGTCGATGAAGCTTGAGAGAGTATTTGGTTGTTTAGCTTCCATTTTCATTTTT
 
. : . : . : . : . : . :
JMSF029J13+ CATCAAGAAATGATAAACCCTAAATTTGTATTTGGGGGGTTTTTGGAGTACGCAAGGATT
                      ____________________________________________________________
consensus CATCAAGAAATGATAAACCCTAAATTTGTATTTGGGGGGTTTTTGGAGTACGCAAGGATT
 
. : . : . : . : . : . :
JMSF029J13+ AGGTTTGGTTCTAAAATAGGTTGAGGTGCTAAGTGCTTAACTCAGAATCCAGTCGCTTGT
                      ____________________________________________________________
consensus AGGTTTGGTTCTAAAATAGGTTGAGGTGCTAAGTGCTTAACTCAGAATCCAGTCGCTTGT
 
. : . : . : . : . : . :
JMSF029J13+ GCTAGCCACTGAGTGAGCCGTGAGCCTTCAGGTTTGAGGAGACTGTCGGCTGCTATTAGA
                      ____________________________________________________________
consensus GCTAGCCACTGAGTGAGCCGTGAGCCTTCAGGTTTGAGGAGACTGTCGGCTGCTATTAGA
 
. : . : . : . : . : . :
JMSF029J13+ GTGACAAACTGAGAGGTCAGCCGGCTCGCCGCGCCGGAGAAGACTGCCGCCTGCTGGCTG
                      ____________________________________________________________
consensus GTGACAAACTGAGAGGTCAGCCGGCTCGCCGCGCCGGAGAAGACTGCCGCCTGCTGGCTG
 
. : . : . : . : . : . :
JMSF029J13+ GCTGCGACGGCGTGGGAGACTGAGAGACGGAGAGGAGTTGACAGAAGACACTAATCGCCC
                      ____________________________________________________________
consensus GCTGCGACGGCGTGGGAGACTGAGAGACGGAGAGGAGTTGACAGAAGACACTAATCGCCC