Previous Contig 006601:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS116G11Sequence599006601 (2)pir|A85055|A850557e-52probable leucyl tRNA synthetase [imported] - Arabidopsis thaliana>gb:ATCHRIV12_1
JMSF029J02Sequence620006601 (2)pir|A85055|A850552e-53probable leucyl tRNA synthetase [imported] - Arabidopsis thaliana>gb:ATCHRIV12_1123002533 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS116G11+ ACCGGAAGCGGT
JMSF029J02+ GAGCTGTAACCGGAAGCGGT
                      ____________________________________________________________
consensus GAGCTGTAACCGGAAGCGGT
 
. : . : . : . : . : . :
JMFS116G11+ TTATATTTCTTATTGTTGTGATTCTTGGGTGTGTGCCTGTCTCTATTGCATATTGCTCTG
JMSF029J02+ TTATATTTCTTATTGTTGTGATTCTTGGGTGTGTGCCTGTCTCTATTGCATATTGCTCTG
                      ____________________________________________________________
consensus TTATATTTCTTATTGTTGTGATTCTTGGGTGTGTGCCTGTCTCTATTGCATATTGCTCTG
 
. : . : . : . : . : . :
JMFS116G11+ CAGGTAAGCCAAAGGCATCCCATCCCATTGGGTGCAAAACATTGTAACCTTGCATCCGCT
JMSF029J02+ CAGGTAAGCCAAAGGCATCCCATCCCATTGGGTGCAAAACATTGTAACCTTGCATCCGCT
                      ____________________________________________________________
consensus CAGGTAAGCCAAAGGCATCCCATCCCATTGGGTGCAAAACATTGTAACCTTGCATCCGCT
 
. : . : . : . : . : . :
JMFS116G11+ TAAATCTAGCAAGGATATCTGTAGCAGTGTATCCAAGAGGATGGCCAACATGTAAACCTG
JMSF029J02+ TAAATCTAGCAAGGATATCTGTAGCAGTGTATCCAAGAGGATGGCCAACATGTAAACCTG
                      ____________________________________________________________
consensus TAAATCTAGCAAGGATATCTGTAGCAGTGTATCCAAGAGGATGGCCAACATGTAAACCTG
 
. : . : . : . : . : . :
JMFS116G11+ CTCCACTTGGATATGGGAACATGTCGAGAACATAATACTTGGGTTTCGAAGTGTCAATTT
JMSF029J02+ CTCCACTTGGATATGGGAACATGTCGAGAACATAATACTTGGGTTTCGAAGTGTCAATTT
                      ____________________________________________________________
consensus CTCCACTTGGATATGGGAACATGTCGAGAACATAATACTTGGGTTTCGAAGTGTCAATTT
 
. : . : . : . : . : . :
JMFS116G11+ CATCGGGGGTCCGGAATGTCTTCTTCTCCTCCCAAAATTTCTGCCACTTGGGCTCGATTT
JMSF029J02+ CATCGGGGGTCCGGAATGTCTTCTTCTCCTCCCAAAATTTCTGCCACTTGGGCTCGATTT
                      ____________________________________________________________
consensus CATCGGGGGTCCGGAATGTCTTCTTCTCCTCCCAAAATTTCTGCCACTTGGGCTCGATTT
 
. : . : . : . : . : . :
JMFS116G11+ CGTGAAAGGGGTAGGCTCGCCTCACTTGTTGCTCTTCATTTTCCTTCTGCTCATCCTCCA
JMSF029J02+ CGTGAAAGGGGTAGGCTCGCCTCACTTGTTGCTCTTCATTTTCCTTCTGCTCATCCTCCA
                      ____________________________________________________________
consensus CGTGAAAGGGGTAGGCTCGCCTCACTTGTTGCTCTTCATTTTCCTTCTGCTCATCCTCCA
 
. : . : . : . : . : . :
JMFS116G11+ CTTTAACGCAGCTTATACCATTGGTTTTGCTGACACAATTGGAGAGCCTGAGGCGGAGGA
JMSF029J02+ CTTTAACGCAGCTTATACCATTGGTTTTGCTGACACAATTGGAGAGCCTGAGGCGGAGGA
                      ____________________________________________________________
consensus CTTTAACGCAGCTTATACCATTGGTTTTGCTGACACAATTGGAGAGCCTGAGGCGGAGGA
 
. : . : . : . : . : . :
JMFS116G11+ AGGAGAATGAGCGACGGCGGAGAAGAGGCCTGAAGTGGGTGGAGATAAGCAACTCACGGC
JMSF029J02+ AGGAGAATGAGCGACGGCGGAGAAGAGGCCTGAAGTGGGTGGAGATAAGCAACTCACGGC
                      ____________________________________________________________
consensus AGGAGAATGAGCGACGGCGGAGAAGAGGCCTGAAGTGGGTGGAGATAAGCAACTCACGGC
 
. : . : . : . : . : . :
JMFS116G11+ GGCAAAACGGAGGCTGAGAAAAGGGCTGTTGAAGCAAGCGGAGGCGCGAGTGAATCTCGA
JMSF029J02+ GGCAAAACGGAGGCTGAGAAAAGGGCTGTTGAAGCAAGCGGAGGCGCGAGTGAATCTCGA
                      ____________________________________________________________
consensus GGCAAAACGGAGGCTGAGAAAAGGGCTGTTGAAGCAAGCGGAGGCGCGAGTGAATCTCGA
 
. : . : . : . : . : . :
JMFS116G11+ ATTGGGTGTTCATTGTGCTTTGGAAGGGAGAAGTGAGGCGTGGCTGA
JMSF029J02+ ATTGGGTGTTCATTGTGCTTTGGAAGGGAGAAGTGAGGCGTGGCTGAGTGGTGGTGGACC
                      ____________________________________________________________
consensus ATTGGGTGTTCATTGTGCTTTGGAAGGGAGAAGTGAGGCGTGGCTGAGTGGTGGTGGACC