Previous Contig 006598:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008F13Sequence487006598 (4)gb:AB023033_15153456e-56Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6M13.500012654 (5)gb:AY070478_15668612e-70Arabidopsis thaliana AT5g49550/K6M13_10 mRNA, complete cds.>gb:BT005815_1638737
JMFF027D01Sequence519006598 (4)gb:AB023033_15153453e-61Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6M13.525012654 (5)gb:AY070478_15668613e-77Arabidopsis thaliana AT5g49550/K6M13_10 mRNA, complete cds.>gb:BT005815_1638737
JMSF011D05Sequence304006598 (4)gb:AB023033_15153451e-28Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6M13.539012654 (5)gb:AY070478_15668614e-74Arabidopsis thaliana AT5g49550/K6M13_10 mRNA, complete cds.>gb:BT005815_1638737
JMSF029I20Sequence665006598 (4)gb:AB023033_15153454e-76Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6M13.766012654 (5)gb:AY070478_1566861e-117Arabidopsis thaliana AT5g49550/K6M13_10 mRNA, complete cds.>gb:BT005815_1638737

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029I20+ TGTGA
                      ____________________________________________________________
consensus TGTGA
 
. : . : . : . : . : . :
JMSF029I20+ GTGCACTTCGTAGGCAGTGAGACCAAAAGGCTGATTTCTCTAACTTATTATGCAGTCGGG
                      ____________________________________________________________
consensus GTGCACTTCGTAGGCAGTGAGACCAAAAGGCTGATTTCTCTAACTTATTATGCAGTCGGG
 
. : . : . : . : . : . :
JMFF027D01+ TGGATCCA
JMSF029I20+ CATTAAAAGATGGATTTCCTTGTAGAGCTTCAGGTGGTGAAGAATCCAAAAGTGGATCCA
                      ____________________________________________________________
consensus CATTAAAAGATGGATTTCCTTGTAGAGCTTCAGGTGGTGAAGAATCCAAAAGTGGATCCA
 
. : . : . : . : . : . :
JMFF027D01+ AAAATTTGCAGAACTTGTCTAGCTGGTTCTCATACCTCGCAAAAGCCTTGGCATCACGTT
JMFF008F13+ GGTTCTCATACCTCGCAAAAGCCTTGGCATCACGTT
JMSF029I20+ AAAATTTGCAGAACTTGTCTAGCTGGTTCTCATACCTCGCAAAAGCCTTGGCATCACGTT
                      ____________________________________________________________
consensus AAAATTTGCAGAACTTGTCTAGCTGGTTCTCATACCTCGCAAAAGCCTTGGCATCACGTT
 
. : . : . : . : . : . :
JMFF027D01+ CGGAGAACTTGGAAATTTCAGAATAGTTATGCTGTTTATCTCTACCAAGCATGAGATAGC
JMFF008F13+ CGGAGAACTTGGAAATTTCAGAATAGTTATGCTGTTTATCTCTACCAAGCATGAGATAGC
JMSF029I20+ CGGAGAACTTGGAAATTTCAGAATAGTTATGCTGTTTATCTCTACCAAGCATGAGATAGC
                      ____________________________________________________________
consensus CGGAGAACTTGGAAATTTCAGAATAGTTATGCTGTTTATCTCTACCAAGCATGAGATAGC
 
. : . : . : . : . : . :
JMFF027D01+ GTCCATCACGACAGGGAGTAAATGATGATGGATTTCTCTTTAATAGCTTTAATCCATGTC
JMFF008F13+ GTCCATCACGACAGGGAGTAAATGATGATGGATTTCTCTTTAATAGCTTTAATCCATGTC
JMSF029I20+ GTCCATCACGACAGGGAGTAAATGATGATGGATTTCTCTTTAATAGCTTTAATCCATGTC
                      ____________________________________________________________
consensus GTCCATCACGACAGGGAGTAAATGATGATGGATTTCTCTTTAATAGCTTTAATCCATGTC
 
. : . : . : . : . : . :
JMFF027D01+ GTTTTAGCTCTAGTTCTTTGATGACGCAGGGGCGGAGGAGGCTTTGGAGGTAGCTACAAC
JMFF008F13+ GTTTTAGCTCTAGTTCTTTGATGACGCAGGGGCGGAGGAGGCTTTGGAGGTAGCTACAAC
JMSF011D05+ GGGGCGGAGGAGGCTTTGGAGGTAGCTACAAC
JMSF029I20+ GTTTTAGCTCTAGTTCTTTGATGACGCAGGGGCGGAGGAGGCTTTGGAGGTAGCTACAAC
                      ____________________________________________________________
consensus GTTTTAGCTCTAGTTCTTTGATGACGCAGGGGCGGAGGAGGCTTTGGAGGTAGCTACAAC
 
. : . : . : . : . : . :
JMFF027D01+ GGGAGAATTTGAAGCCAGGAACAAGCTCCTCGGTGACGGCAGCACCGCCGATGACGTGGC
JMFF008F13+ GGGAGAATTTGAAGCCAGGAACAAGCTCCTCGGTGACGGCAGCACCGCCGATGACGTGGC
JMSF011D05+ GGGAGAATTTGAAGCCAGGAACAAGCTCCTCGGTGACGGCAGCACCGCCGATGACGTGGC
JMSF029I20+ GGGAGAATTTGAAGCCAGGAACAAGCTCCTCGGTGACGGCAGCACCGCCGATGACGTGGC
                      ____________________________________________________________
consensus GGGAGAATTTGAAGCCAGGAACAAGCTCCTCGGTGACGGCAGCACCGCCGATGACGTGGC
 
. : . : . : . : . : . :
JMFF027D01+ GTCTCTCGAGGACGGCGACGGAGAGGCCGGAGCGAGCAAGGTAGGCAGCAGCGGTTAGGC
JMFF008F13+ GTCTCTCGAGGACGGCGACGGAGAGGCCGGAGCGAGCAAGGTAGGCAGCAGCGGTTAGGC
JMSF011D05+ GTCTCTCGAGGACGGCGACGGAGAGGCCGGAGCGAGCAAGGTAGGCAGCAGCGGTTAGGC
JMSF029I20+ GTCTCTCGAGGACGGCGACGGAGAGGCCGGAGCGAGCAAGGTAGGCAGCAGCGGTTAGGC
                      ____________________________________________________________
consensus GTCTCTCGAGGACGGCGACGGAGAGGCCGGAGCGAGCAAGGTAGGCAGCAGCGGTTAGGC
 
. : . : . : . : . : . :
JMFF027D01+ CGTTATGGCCACCGCCGATCACCAGTGCGTCCCATTTCTTCTCCTTCAAAGCTCGCTCCG
JMFF008F13+ CGTTATGGCCACCGCCGATCACCAGTGCGTCCCATTTCTTCTCCTTCAAAGCTCGCTCCG
JMSF011D05+ CGTTATGGCCACCGCCGATCACCAGTGCGTCCCATTTCTTCTCCTTCAAAGCTCGCTCCG
JMSF029I20+ CGTTATGGCCACCGCCGATCACCAGTGCGTCCCATTTCTTCTCCTTCAAAGCTCGCTCCG
                      ____________________________________________________________
consensus CGTTATGGCCACCGCCGATCACCAGTGCGTCCCATTTCTTCTCCTTCAAAGCTCGCTCCG
 
. : . : . : . : . : . :
JMFF027D01+ AGTTCGCAGTAGAGCTGCCGCTCAGTTTCCGGCACTGTCGCCACATTTCTTATAATTTGC
JMFF008F13+ AGTTCGCAGTAGAGCTGCCGCTCAGTTTCCGGCACTGTCGCCACATTTCTTATAATTTGC
JMSF011D05+ AGTTCGCAGTAGAGCTGCCGCTCAGTTTCCGGCACTGTCGCCACATTTCTTATAATTTGC
JMSF029I20+ AGTTCGCAGTAGAGCTGCCGCTCAGTTTCCGGCACTGTCGCCACATTTCTTATAATTTGC
                      ____________________________________________________________
consensus AGTTCGCAGTAGAGCTGCCGCTCAGTTTCCGGCACTGTCGCCACATTTCTTATAATTTGC
 
. : . : . : . : . : . :
JMFF027D01+ TATCACCTCCGCTCCACTCTCTCTCTCAAT
JMFF008F13+ TATCACCTCCGCTCCACTCTCTCTCTCAAT
JMSF011D05+ TATCACCTCCGCTCCACTCTCTCTCTCAAT
JMSF029I20+ TATCACCTCCGCTCCACTCTCTCTCTCAATTACCAGCTGCTTGTCGCGTACTTATATGTC
                      ____________________________________________________________
consensus TATCACCTCCGCTCCACTCTCTCTCTCAATTACCAGCTGCTTGTCGCGTACTTATATGTC