Previous Contig 006597:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008L20Sequence577006597 (7)gb:AP004341_18404851e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P052729020831
JMFF040A19Sequence391006597 (7)gb:AP004376_18409584e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048623006597 (7)
JMFF046K22Sequence568006597 (7)gb:AP004341_18404851e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P052
JMSF029I19Sequence603006597 (7)gb:AP004376_18409584e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048
JMSF040G22Sequence580006597 (7)gb:AP004376_18409581e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P048807006597 (7)gb:AC103551_17372861e-11Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040G22- AGCAGAAGAAATTCCGAGTCCACCGCATAGCCACAATGCTAACAGTAAAGTAAA
                      ____________________________________________________________
consensus AGCAGAAGAAATTCCGAGTCCACCGCATAGCCACAATGCTAACAGTAAAGTAAA
 
. : . : . : . : . : . :
rJMFF040A19- ACTATTATCATAACTAAGTATTG
rJMSF040G22- CCAAAACCAGTTGCCAATCCACAGACAACAGTACACAACTATTATCATAACTAAGTATTG
                      ____________________________________________________________
consensus CCAAAACCAGTTGCCAATCCACAGACAACAGTACACAACTATTATCATAACTAAGTATTG
 
. : . : . : . : . : . :
rJMFF040A19- CAATGCATCAAGTACAACAAAAGAGTAGAAACCTTAAAAATAAGTTTGGGCCAATCATTT
rJMSF040G22- CAATGCATCAAGTACAACAAAAGAGTAGAAACCTTAAAAATAAGTTTGGGCCAATCATTT
                      ____________________________________________________________
consensus CAATGCATCAAGTACAACAAAAGAGTAGAAACCTTAAAAATAAGTTTGGGCCAATCATTT
 
. : . : . : . : . : . :
rJMFF040A19- CTAGAAAGCACTAAACAGACGGTTCGGTGTTGATATGGAACTGCCCGCTTCTGGGATAAG
rJMSF040G22- CTAGAAAGCACTAAACAGACGGTTCGGTGTTGATATGGAACTGCCCGCTTCTGGGATAAG
                      ____________________________________________________________
consensus CTAGAAAGCACTAAACAGACGGTTCGGTGTTGATATGGAACTGCCCGCTTCTGGGATAAG
 
. : . : . : . : . : . :
rJMFF040A19- GAAACTGAAACAGACCCGTGTTGGGGACCCATCAATTGCTCATTCAATTCATTCATCANC
rJMSF040G22- GAAACTGAAACAGACCCGTGTTGGGGACCCATCAATTGCTCATTCAATTCATTCATCAGC
                      ____________________________________________________________
consensus GAAACTGAAACAGACCCGTGTTGGGGACCCATCAATTGCTCATTCAATTCATTCATCAGC
 
. : . : . : . : . : . :
rJMFF040A19- ATCATAACGAGGAGATGGGCTACGAGAATCAGCCCGCCGCCCACGGGGTGACAAACTTTT
rJMSF040G22- ATCATAACGAGGAGATGGGCTACGAGAATCAGCCCGCCGCCCACGGGGTGACAAACTTTT
                      ____________________________________________________________
consensus ATCATAACGAGGAGATGGGCTACGAGAATCAGCCCGCCGCCCACGGGGTGACAAACTTTT
 
. : . : . : . : . : . :
rJMFF040A19- CGGAGTTAGAGAACGTTCATTGTGATTCCCTGCTTTTGGGCTTCCATCCCTAGGGGAAGT
rJMSF040G22- CGGAGTTAGAGAACGTTCATTGTGATTCCCTGCTTTTGGGCTTCCATCCCTAGGGGAAGT
                      ____________________________________________________________
consensus CGGAGTTAGAGAACGTTCATTGTGATTCCCTGCTTTTGGGCTTCCATCCCTAGGGGAAGT
 
. : . : . : . : . : . :
rJMFF040A19- CCTGCGAGGAGATGGGCTCCTCCTTGGACTTGGGCTGCGCCGAGCAGGAGAGGCACTTCC
rJMSF040G22- CCTGCGAGGAGATGGGCTCCTCCTTGGACTTGGGCTGCGCCGAGCAGGAGAGGCACTTCC
                      ____________________________________________________________
consensus CCTGCGAGGAGATGGGCTCCTCCTTGGACTTGGGCTGCGCCGAGCAGGAGAGGCACTTCC
 
. : . : . : . : . : . :
rJMFF040A19- ATAAGAACGACTTCGACTGCGCCTCTCATCATCATATCTACCTCTCCCACGATCTTTGCG
rJMSF040G22- ATAAGAACGACTTCGACTGCGCCTCTCATCATCATATCTACCTCTCCCACGATCTTTGCG
JMSF040G22+ TGCG
JMSF029I19+ TGCG
                      ____________________________________________________________
consensus ATAAGAACGACTTCGACTGCGCCTCTCATCATCATATCTACCTCTCCCACGATCTTTGCG
 
. : . : . : . : . : . :
rJMFF040A19- GTTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
rJMSF040G22- GTTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
JMFF008L20+ TTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
JMSF040G22+ GTTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
JMFF046K22+ CTCGCACTGCGACTTCTGTTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
JMSF029I19+ GTTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
                      ____________________________________________________________
consensus GTTATCAGGACTCGCACTGCGACTTCTGCTTCGGGGAGGATAGTCTCGTTCCTTTCCACG
 
. : . : . : . : . : . :
rJMFF040A19- GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
rJMSF040G22- GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
JMFF008L20+ GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATTCCCC
JMSF040G22+ GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
JMFF046K22+ GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
JMSF029I19+ GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
                      ____________________________________________________________
consensus GTAGCGATCACGTTCATACCTTCCTTTACTTCTGCTCCTGCTTCTCCTTCTATATT-CCC
 
. : . : . : . : . : . :
rJMFF040A19- TGTCACTGTNATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
rJMSF040G22- TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
JMFF008L20+ TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
JMSF040G22+ TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
JMFF046K22+ TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
JMSF029I19+ TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
                      ____________________________________________________________
consensus TGTCACTGTAATGATCTCTATACTTTGGTTTAGGACTGTGGCTCCTTGACCGTCCTCTTG
 
. : . : . : . : . : . :
rJMFF040A19- T
rJMSF040G22- TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATTGGGGCCATACT
JMFF008L20+ TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATTGGGGCCATACT
JMSF040G22+ TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATTGGGGCCATACT
JMFF046K22+ TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATTGGGGCCATACT
JMFF040A19+ CTTGTGAATCCTTTCAGCATTGGGGCCATACT
JMSF029I19+ TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATCGGGGCCATACT
                      ____________________________________________________________
consensus TCTTGTACACAGGCTCCTCAATTCTTCCCTTGTGAATCCTTTCAGCATTGGGGCCATACT
 
. : . : . : . : . : . :
rJMSF040G22- TTGCAAACTGAACCATCATCTCTCTTCCATCAAC
JMFF008L20+ TTGCAAACTGAACCATTATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
JMSF040G22+ TTGCAAACTGAACCATCATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
JMFF046K22+ TTGCAAACTGAACCATTATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
JMFF040A19+ TTGCAAACTGAACCATTATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
JMSF029I19+ TTGCAAACTGAACCATTATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
                      ____________________________________________________________
consensus TTGCAAACTGAACCATTATCTCTCTTCCATCAACAAGTTTTCCATCAAGCTTTTCAACTG
 
. : . : . : . : . : . :
JMFF008L20+ CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
JMSF040G22+ CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
JMFF046K22+ CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
JMFF040A19+ CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
JMSF029I19+ CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
                      ____________________________________________________________
consensus CCTTCTGAGCCTCATCCTGATATTTGTACCTGACAAATGCAAAACCCCGCGAGTCCCCAG
 
. : . : . : . : . : . :
JMFF008L20+ TCCTTCGGTCTCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
JMSF040G22+ TCCTTCGG--TCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
JMFF046K22+ TCCTTCGGTCTCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
JMFF040A19+ TCCTTCGGTCTCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
JMSF029I19+ TCCTTCGGTCTCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
                      ____________________________________________________________
consensus TCCTTCGGTCTCTAGGGATGAAGACGTCGACAACTTTCCCGTACCTATCGAAGAGGGGAT
 
. : . : . : . : . : . :
JMFF008L20+ ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
JMSF040G22+ ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
JMFF046K22+ ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
JMFF040A19+ ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
JMSF029I19+ ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
                      ____________________________________________________________
consensus ACAAGTCATCGGCGGTGGTACGGAAAGTGATGTTGAGGACGAGGAGAGAGAAGGTGTCTC
 
. : . : . : . : . : . :
JMFF008L20+ TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCAG
JMSF040G22+ TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCAG
JMFF046K22+ TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCCT
JMFF040A19+ TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCAG
JMSF029I19+ TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCAG
                      ____________________________________________________________
consensus TGATGTCCGGAGGGCCTGATCTTCCGAAGTGCGACATCGCCGGCTGCTTTAGGAGCTCAG
 
. : . : . : . : . : . :
JMFF008L20+ AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTT
JMSF040G22+ AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTT
JMFF046K22+ AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTT
JMFF040A19+ AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTTAGGGTTTGAGAGGGCGACCGT
JMSF029I19+ AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTTAGGGTTTGAGAGGGCGACCGTC
                      ____________________________________________________________
consensus AACTCTCTCGAAGTAGCAGAAATAAGAAGAATGTTGTTAGGGTTTGAGAGGGCGACCGTC