Previous Contig 006592:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029I02Sequence678006592 (2)gb:AF270978_17821212e-84Adonis palaestina LYTB-like protein precursor (lytB) mRNA, complete cds.685012651 (2)gb:AF159699_17732527e-84Nicotiana tabacum putative host factor mRNA, partial cds.
JMSF044J04Sequence761006592 (2)gb:AF270978_17821213e-99Adonis palaestina LYTB-like protein precursor (lytB) mRNA, complete cds.718012651 (2)gb:AF398145_17958938e-89Brassica rapa subsp. pekinensis LYTB-like protein 1 (lytB) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044J04+ TCATGAGAATATTTTACCATGGATCACGGAGGTGTGTTCAC
                      ____________________________________________________________
consensus TCATGAGAATATTTTACCATGGATCACGGAGGTGTGTTCAC
 
. : . : . : . : . : . :
JMSF044J04+ CTTTCTTGTGTTTCTCAACTACATTCCAAACCTTAGAAACCCATGGGCAGGTTGTATCAA
JMSF029I02+ ATGGNCAGGTTGTATCAA
                      ____________________________________________________________
consensus CTTTCTTGTGTTTCTCAACTACATTCCAAACCTTAGAAACCCATGGGCAGGTTGTATCAA
 
. : . : . : . : . : . :
JMSF044J04+ CTATTTGTACATTCTTTTCACTCAAAGTTAACATCTCATCGACAGCAGCCCCAAACGCAG
JMSF029I02+ CTATTTGTACATTCTTTTCACTCAAAGTTAACATCTCATCGACAGCAGCCCCAAACGCAG
                      ____________________________________________________________
consensus CTATTTGTACATTCTTTTCACTCAAAGTTAACATCTCATCGACAGCAGCCCCAAACGCAG
 
. : . : . : . : . : . :
JMSF044J04+ GCAAAACCACAACATCACCCTTGTCAACAACATTAAAATTTTTCTCTCCTTGGTCAATGG
JMSF029I02+ GCAAAACCACAACATCACCCTTGTCAACAACATTAAAATTTTTCTCTCCTTGGTCAATGG
                      ____________________________________________________________
consensus GCAAAACCACAACATCACCCTTGTCAACAACATTAAAATTTTTCTCTCCTTGGTCAATGG
 
. : . : . : . : . : . :
JMSF044J04+ GGATATTCTTGACTTCCATTTCCTCAAGCCGCTTATTCACTGTAGGGTTGTGTATAATTT
JMSF029I02+ GGATATTCTTGACTTCCATTTCCTCAAGCCGCTTATTCACTGTAGGGTTGTGTATAATTT
                      ____________________________________________________________
consensus GGATATTCTTGACTTCCATTTCCTCAAGCCGCTTATTCACTGTAGGGTTGTGTATAATTT
 
. : . : . : . : . : . :
JMSF044J04+ CATTTGTGATCCAAATCCTCTCAGTTGGAAATTGTTTTCTCGCTTCATACGCAATCTGGA
JMSF029I02+ CATTTGTGATCCAAATCCTCTCAGTTGGAAATTGTTTTCTCGCTTCATACGCAATCTGGA
                      ____________________________________________________________
consensus CATTTGTGATCCAAATCCTCTCAGTTGGAAATTGTTTTCTCGCTTCATACGCAATCTGGA
 
. : . : . : . : . : . :
JMSF044J04+ CTGCTCGCTCAACCCCCCAGCAGAAGCCATAGGCTTCTGCAAGTTTTATGGTAACATTTC
JMSF029I02+ CTGCTCGCTCAACCCCCCAGCAGAAGCCATAGGCTTCTGCAAGTTTTATGGTAACATTTC
                      ____________________________________________________________
consensus CTGCTCGCTCAACCCCCCAGCAGAAGCCATAGGCTTCTGCAAGTTTTATGGTAACATTTC
 
. : . : . : . : . : . :
JMSF044J04+ CCCATGTATATTCGTAGCCATTCTCTTTCAACTTCTTTATAATATCACTAGTATACTCGC
JMSF029I02+ CCCATGTATATTCGTAGCCATTCTCTTTCAACTTCTTTATAATATCACTAGTATACTCGC
                      ____________________________________________________________
consensus CCCATGTATATTCGTAGCCATTCTCTTTCAACTTCTTTATAATATCACTAGTATACTCGC
 
. : . : . : . : . : . :
JMSF044J04+ GATTCATGAGCTCAAGAGTAGCTTCTTTGTGACCAAAGCCCTTGCGATTGTAATTCGCAC
JMSF029I02+ GATTCATGAGCTCAAGAGTAGCTTCTTTGTGACCAAAGCCCTTGCGATTGTAATTCGCAC
                      ____________________________________________________________
consensus GATTCATGAGCTCAAGAGTAGCTTCTTTGTGACCAAAGCCCTTGCGATTGTAATTCGCAC
 
. : . : . : . : . : . :
JMSF044J04+ TTCTGGTCAAGTTCTTCCGGAACGTCTTAGGATCAAACTCCGAATCTACGG
JMSF029I02+ TTCTGGTCAAGTTCTTCCGGAACGTCTTAGGATCAAACTCCGAATCTACGGCCGGCGAGG
                      ____________________________________________________________
consensus TTCTGGTCAAGTTCTTCCGGAACGTCTTAGGATCAAACTCCGAATCTACGGCCGGCGAGG
 
. : . : . : . : . : . :
JMSF029I02+ AGGAGGAAGCTGTTTCTCCGGCGGAGCATCGGACTGAGAGAGGCTTCCGGAGATGGAAGA
                      ____________________________________________________________
consensus AGGAGGAAGCTGTTTCTCCGGCGGAGCATCGGACTGAGAGAGGCTTCCGGAGATGGAAGA
 
. : . : . : . : . : . :
JMSF029I02+ CTCTAGACTCCGGCAAGGAGATGTCGGTACGGATTGGTAAACGGGAGAATTGCAGAGGAA
                      ____________________________________________________________
consensus CTCTAGACTCCGGCAAGGAGATGTCGGTACGGATTGGTAAACGGGAGAATTGCAGAGGAA
 
. : . : . : . : . : . :
JMSF029I02+ TAGACATGATTCAGGGGAGAGTGCGCACGTTAGCTGATTGCGTTTGCAGTGTTGGAGCCC
                      ____________________________________________________________
consensus TAGACATGATTCAGGGGAGAGTGCGCACGTTAGCTGATTGCGTTTGCAGTGTTGGAGCCC