Previous Contig 006588:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022G22Sequence689006588 (3)159023028
JMSF029H03Sequence625006588 (3)723013299 (2)gb:CR382121_16546490.042Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL Y-1140 of Kl
JMSF040J11Sequence596006588 (3)805013299 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022G22+ AATCCATAGACTCAACACATGTAGTTTGCAACATAATA
                      ____________________________________________________________
consensus AATCCATAGACTCAACACATGTAGTTTGCAACATAATA
 
. : . : . : . : . : . :
JMSF022G22+ GTCATACTATAANCAAAATAAACAAATTAAATGTAATAGAATTACTCACGGCTTCATCTT
                      ____________________________________________________________
consensus GTCATACTATAANCAAAATAAACAAATTAAATGTAATAGAATTACTCACGGCTTCATCTT
 
. : . : . : . : . : . :
JMSF022G22+ GAAGAATAATTGGTCTGTATTTATTACCCGGCGTGGTTTTGGATTCTTGGGCATCCAATT
                      ____________________________________________________________
consensus GAAGAATAATTGGTCTGTATTTATTACCCGGCGTGGTTTTGGATTCTTGGGCATCCAATT
 
. : . : . : . : . : . :
JMSF022G22+ TGTTTACAACACATACCTTACAAGACCAATCTTGTTCTCCAGGAGATACATCAGATATCA
JMSF029H03+ TCTCCAGGAGATACATCAGATATCA
                      ____________________________________________________________
consensus TGTTTACAACACATACCTTACAAGACCAATCTTGTTCTCCAGGAGATACATCAGATATCA
 
. : . : . : . : . : . :
JMSF022G22+ ACAATCTTCTCACCATTCTTATAAGCTTTTCTTTAAAGCAAATAGTTTTTTCGAAACCTC
JMSF040J11+ TCTTCTCACCATTCTTATAAGCTTTTCTTTAAAGCAAATAGTTTTTTCGAAACCTC
JMSF029H03+ ACAATCTTCTCACCATTCTTATAAGCTTTTCTTTAAAGCAAATAGTTTTTTCGAAACCTC
                      ____________________________________________________________
consensus ACAATCTTCTCACCATTCTTATAAGCTTTTCTTTAAAGCAAATAGTTTTTTCGAAACCTC
 
. : . : . : . : . : . :
JMSF022G22+ TATCCGAACTGGAGAAACCGAAACCAATTTCCTGGCATGCAAGCTAAACACACCAATTTC
JMSF040J11+ TATCCGAACTGGAGAAACCGAAACCAATTTCCTGGCATGCAAGCTAAACACACCAATTTC
JMSF029H03+ TATCCGAACTGGAGAAACCGAAACCAATTTCCTGGCATGCAAGCTAAACACACCAATTTC
                      ____________________________________________________________
consensus TATCCGAACTGGAGAAACCGAAACCAATTTCCTGGCATGCAAGCTAAACACACCAATTTC
 
. : . : . : . : . : . :
JMSF022G22+ GTAGTTTTGAGA-----------------AGCAATCAGAAATTATGCAACTGAAAACACT
JMSF040J11+ GTAGTTTTGAGAAGTTTGGCAGAACTCACAGCAATCAGAAATTATGCAACTGAAAACACT
JMSF029H03+ GTAGTTTTGAGAAGTTTGGCAGAACTCACAGCAATCAGAAATTATGCAACTGAAAACACT
                      ____________________________________________________________
consensus GTAGTTTTGAGAAGTTTGGCAGAACTCACAGCAATCAGAAATTATGCAACTGAAAACACT
 
. : . : . : . : . : . :
JMSF022G22+ CCTTTGCATATATTGGTGTGATAGAGACTTTTGAGGAGGGTAATTAAACAGACCATTGTA
JMSF040J11+ CCTTTGCATATATTGGTGTGATAGAGACTTTTGAGGAGGGTAATTAAACAGACCATTGTA
JMSF029H03+ CCTTTGCATATATTGGTGTGATAGAGACTTTTGAGGAGGGTAATTAAACAGACCATTGTA
                      ____________________________________________________________
consensus CCTTTGCATATATTGGTGTGATAGAGACTTTTGAGGAGGGTAATTAAACAGACCATTGTA
 
. : . : . : . : . : . :
JMSF022G22+ TAATTCACTCATCTCTGTACCTACCGTTGAAATGTCTAGAGGATAATGTAATTGAGAAGG
JMSF040J11+ TAATTCACTCATCTCTGTACCTACCGTTGAAATGTCTAGAGGATAATGTAATTGAGAAGG
JMSF029H03+ TAATTCACTCATCTCTGTACCTACCGTTGAAATGTCTAGAGGATAATGTAATTGAGAAGG
                      ____________________________________________________________
consensus TAATTCACTCATCTCTGTACCTACCGTTGAAATGTCTAGAGGATAATGTAATTGAGAAGG
 
. : . : . : . : . : . :
JMSF022G22+ AAACATCTGAAAAATTTTTAATTTCCGTACACATTGATAGCAAGCCTGTAGTAATCTCTC
JMSF040J11+ AAACATCTGAAAAATTTTTAATTTCCGTACACATTGATAGCAAGCCTGTAGTAATCTCTC
JMSF029H03+ AAACATCTGAAAAATTTTTAATTTCCGTACACATTGATAGCAAGCCTGTAGTAATCTCTC
                      ____________________________________________________________
consensus AAACATCTGAAAAATTTTTAATTTCCGTACACATTGATAGCAAGCCTGTAGTAATCTCTC
 
. : . : . : . : . : . :
JMSF022G22+ TTTCCTTTTGCTTATTTCCATCTATACCTGGTTGGTTTAACTAAGGAATGAAGATGATGG
JMSF040J11+ TTTCCTTTTGCTTATTTCCATCTATACCTGGTTGGTTTAACTAAGGAATGAAGATGATGG
JMSF029H03+ TTTCCTTTTGCTTATTTCCATCTATACCTGGTTGGTTTAACTAAGGAATGAAGATGATGG
                      ____________________________________________________________
consensus TTTCCTTTTGCTTATTTCCATCTATACCTGGTTGGTTTAACTAAGGAATGAAGATGATGG
 
. : . : . : . : . : . :
JMSF022G22+ AAAAACACAGAGTAGAGAAGAAAGAGAGAGGCACATGGGTAGAGAAGAAAAAAAGAAATG
JMSF040J11+ AAAAACACAGAGTAGAGAAGAAAGAGAGAGGCACATGGGTAGAGAAGAAAAAAAGAAATG
JMSF029H03+ AAAAACACAGAGTAGAGAAGAAAGAGAGAGGCACATGGGTAGAGAAGAAAAAAAGAAATG
                      ____________________________________________________________
consensus AAAAACACAGAGTAGAGAAGAAAGAGAGAGGCACATGGGTAGAGAAGAAAAAAAGAAATG
 
. : . : . : . : . : . :
JMSF022G22+ GGTTGA
JMSF040J11+ GGTTGATGAAATTGCTATGAAGAAACTAAGTTAGAGAAGAAAGAGAGAAATTAGTTTTAG
JMSF029H03+ GGTTGATGAAATTGCTATGAAGAAACTAAGTTAGAGAAGAAAGAGAGAAATTAGTTTTAG
                      ____________________________________________________________
consensus GGTTGATGAAATTGCTATGAAGAAACTAAGTTAGAGAAGAAAGAGAGAAATTAGTTTTAG
 
. : . : . : . : . : . :
JMSF040J11+ TTGACGGAATTGCTTGGAAGAAACCAGAAAGCCAGCTTAGGAAAACGTGCACCACCACTC
JMSF029H03+ TTGACGGAATTGCTTGGAAGAAACCAGAAAGCCAGCTTAGGAAAACGTGCACCACCACTC
                      ____________________________________________________________
consensus TTGACGGAATTGCTTGGAAGAAACCAGAAAGCCAGCTTAGGAAAACGTGCACCACCACTC