Previous Contig 006587:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029H01Sequence124006587 (2)563012649 (2)gb:CAR299061_16452343e-22Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can189.
JMSF029I01Sequence124006587 (2)528012649 (2)gb:CAR299061_16452342e-22Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can189.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029I01+ TTTT
JMSF029H01+ TTTT
                      ____________________________________________________________
consensus TTTT
 
. : . : . : . : . : . :
JMSF029I01+ TTTTTTCCAATATGTCTTAAGTCTAACTAATCGGAGCACCAAACTGCCATATAATTAAGG
JMSF029H01+ NTTTTTCCAATATGTCTTAAGTCTAACTAATCGGAGCACCAAACTGCCATATAATTAAGG
                      ____________________________________________________________
consensus TTTTTTCCAATATGTCTTAAGTCTAACTAATCGGAGCACCAAACTGCCATATAATTAAGG
 
. : . : . : . : . : . :
JMSF029I01+ ATTTAAGGATTGGTTTTGTTTAAGTAGCTTAAAGATTGAGTATAAGCGAAGCCAATTTCC
JMSF029H01+ ATTTAAGGATTGGTTTTGTTTAAGTAGCTTAAAGATTGAGTATAAGCGAAGCCAATTTCC
                      ____________________________________________________________
consensus ATTTAAGGATTGGTTTTGTTTAAGTAGCTTAAAGATTGAGTATAAGCGAAGCCAATTTCC