Previous Contig 006586:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010B20Sequence637006586 (5)gb:AY174160_15868795e-44Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049
JMFN016K12Sequence398006586 (5)gb:AY174160_15868791e-05Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049
JMFN019C12Sequence598006586 (5)gb:AY174160_15868794e-44Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049
JMSF029G14Sequence635006586 (5)gb:AY174160_15868792e-43Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049772006586 (5)gb:AY174160_15868797e-44Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016K12- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFN016K12- AGGGTCTCGAGXXXXXXXXXXXXXXXXXXXAACTGAATATATTTGGATTGTTGTATGTAT
                      ____________________________________________________________
consensus AGGGTCTCGAGNNNNNNNNNNNNNNNNNNNAACTGAATATATTTGGATTGTTGTATGTAT
 
. : . : . : . : . : . :
JMFN016K12- AGTAATTTTTTTGATTATATAATTTAAACAACTAGTTGAAGGTAAACTATGAACATATAA
JMFN019C12+ GTAATTTTTTTGATTATATAATTTAAACAACTAGTTGAAGGTAAACTATGAACATATAA
rJMSF029G14- GTAATTTTTTTGATTATATAATTTAAACAACTAGTTGAAGGTAAACTATGAACATATAA
                      ____________________________________________________________
consensus AGTAATTTTTTTGATTATATAATTTAAACAACTAGTTGAAGGTAAACTATGAACATATAA
 
. : . : . : . : . : . :
JMFN016K12- TCCCTTCGGATTATACCGGAAAACATCATGGGTGTGCGGCGGCCGGAAAATTGCTGTTTG
JMFN019C12+ TCCCTTCGGATTATACCGGAAAACATCATGGGTGTGCGGCGGCCGGAAAATTGCTGTTTG
JMFN010B20+ ACCGGAAAACATCATGGGTGTGCGGCGGCCGGAAAATTGCTGTTTG
rJMSF029G14- TCCCTTCGGATTATACCGGAAAACATCATGGGTGTGCGGCGGCCGGAAAATTGCTGTTTG
                      ____________________________________________________________
consensus TCCCTTCGGATTATACCGGAAAACATCATGGGTGTGCGGCGGCCGGAAAATTGCTGTTTG
 
. : . : . : . : . : . :
JMFN016K12- GTGTCCGCCGTCGTGGAGGGTCAGTTGTCTTCCTCGGAGCTGTCGGGGCTGGGGTACTCG
JMFN019C12+ GTGTCCGCCGTCGTGGAGGGTCAGTTGTCTTCCTCGGAGCTGTCGGGGCTGGGGTACTCG
JMFN010B20+ GTGTCCGCCGTCGTGGAGGGTCAGTTGTCTTCCTCGGAGCTGTCGGGGCTGGGGTACTCG
rJMSF029G14- GTGTCCGCCGTCGTGGAGGGTCAGTTGTCTTCCTCGGAGCTGTCGGGGCTGGGGTACTCG
                      ____________________________________________________________
consensus GTGTCCGCCGTCGTGGAGGGTCAGTTGTCTTCCTCGGAGCTGTCGGGGCTGGGGTACTCG
 
. : . : . : . : . : . :
JMFN016K12- TTCAAGTCGGGTTTCAAGGGGGCGGGGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
JMFN019C12+ TTCAAGTCGGGTTTCAAGGGGGCGGGGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
JMFN010B20+ TTCAAGTCGGGTTTCAAGGGGGCGGGGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
rJMSF029G14- TTCAAGTCGGGTTTCAAGGGGGCGGGGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
JMSF029G14+ GGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
                      ____________________________________________________________
consensus TTCAAGTCGGGTTTCAAGGGGGCGGGGCGGGTTTGGATCGGGTTCCGGTCGGATTTGGGC
 
. : . : . : . : . : . :
JMFN016K12- GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
JMFN019C12+ GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
JMFN010B20+ GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
rJMSF029G14- GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
JMSF029G14+ GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
                      ____________________________________________________________
consensus GGTGCATGGGGAGCGGTCTGGAGGGCGTCAACCCTAGCTCCGACTTCGGTGGCCTTCTTG
 
. : . : . : . : . : . :
JMFN016K12- CGGATATCGGCGGCGGAAAGGTCTGGGAGCCGATCGT
JMFN019C12+ CGGATATCGGCGGCGGAGAGGTCTGGGAGCCGATCGTCGTGGACGAAGAACTCGGGGAAG
JMFN010B20+ CGGATATCGGCGGCGGAGAGGTCTGGGAGCCGATCGTCGTGGACGAAGAACTCGGGGAAG
rJMSF029G14- CGGATATCGGCGGCGGAGAGGTCTGGGAGCCGATCGTCGTGGACGAAGAACTCGGGGAAG
JMSF029G14+ CGGATATCGGCGGCGGAGAGGTCTGGGAGCCGATCGTCGTGGACGAAGAACTCGGGGAAG
                      ____________________________________________________________
consensus CGGATATCGGCGGCGGAGAGGTCTGGGAGCCGATCGTCGTGGACGAAGAACTCGGGGAAG
 
. : . : . : . : . : . :
JMFN019C12+ TTGAGGCGGGCGGAGGGGCCGCGGAGGTAGAAGACGGCGGTGTCGTAAGCGCGGGCGGCG
JMFN010B20+ TTGAGGCGGGCGGAGGGGCCGCGGAGGTAGAAGACGGCGGTGTCGTAAGCGCGGGCGGCG
rJMSF029G14- TTGAGGCGGGCGGAGGGGCCGCGGAGGTAGAAGACGGCGGTGTCGTAAGCGCGGGCGGCG
JMSF029G14+ TTGAGGCGGGCGGAGGGGCCGCGGAGGTAGAAGACGGCGGTGTCGTAAGCGCGGGCGGCG
                      ____________________________________________________________
consensus TTGAGGCGGGCGGAGGGGCCGCGGAGGTAGAAGACGGCGGTGTCGTAAGCGCGGGCGGCG
 
. : . : . : . : . : . :
JMFN019C12+ GCGACGGGGGAGGAGTAGGAGCCGAGCCAAATCCGGGAGCGTTTGTTGGGCTCGCGAATC
JMFN010B20+ GCGACGGGGGAGGAGTAGGAGCCGAGCCAAATCCGGGAGCGTTTGTTGGGCTCGCGAATC
rJMSF029G14- GCGACGGGGGAGGAGTAGGAGCCGAGCCAAATCCGGGAGCGTTTGTTGGGCTCGCGAATC
JMSF029G14+ GCGACGGGGGAGGAGTAGGAGCCGAGCCAAATCCGGGAGCGTTTGTTGGGCTCGCGAATC
                      ____________________________________________________________
consensus GCGACGGGGGAGGAGTAGGAGCCGAGCCAAATCCGGGAGCGTTTGTTGGGCTCGCGAATC
 
. : . : . : . : . : . :
JMFN019C12+ TCCGCCACCCACTTCCCCCACTTCCTCATGCGAATCCCCCTGTAGGGTTTCTCCTGCTGG
JMFN010B20+ TCCGCCACCCACTTCCCCCACTTCCTCATGCGAATCCCCCTGTAGGGTTTCTCCTGCTGG
rJMSF029G14- TCCGCCACCCACTTCCCCCACTTCCTCATGCGAATCCCCCTGTAGGGTTTCTCCTGCTGG
JMSF029G14+ TCCGCCACCCACTTCCCCCACTTCCTCATGCGAATCCCCCTGTAGGGTTTCTCCTGCTGG
                      ____________________________________________________________
consensus TCCGCCACCCACTTCCCCCACTTCCTCATGCGAATCCCCCTGTAGGGTTTCTCCTGCTGG
 
. : . : . : . : . : . :
JMFN019C12+ CTCTGCCGGCGCTTCCGCTTCTCCGCCTCTCTTCCGCCGTCCATCATCGGAAAATCAA
JMFN010B20+ CTCTGCCGGCGCTTCCGCTTCTCCGCCTCTCTTCCGCCGTCCATCATCGGAAAATCAAGA
rJMSF029G14- CTCTGCCGGCGCTTCCGCTTCTCCGCCTCTCTTCCGCCGTCCATCATCGGAAAATCAAGA
JMSF029G14+ CTCTGCCGGCGCTTCCGCTTCTCCGCCTCTCTTCCGCCGTCCATCATCGGAAAATCAAGA
                      ____________________________________________________________
consensus CTCTGCCGGCGCTTCCGCTTCTCCGCCTCTCTTCCGCCGTCCATCATCGGAAAATCAAGA
 
. : . : . : . : . : . :
JMFN010B20+ ATCCTCAGCTCTTCCCTTACTTAATCAAGCCGCCGGGGATAGCGAAGAACAGGAATAAGG
rJMSF029G14- ATCCTCAGCTCTTCCCTTACTTAATCAAGCCGCCGGGGATAGCGAAGAACAGGAATAAGG
JMSF029G14+ ATCCTCAGCTCTTCCCTTACTTAATCAAGCCGCCGGGGATAGCGAAGAACAGGAATAAGG
                      ____________________________________________________________
consensus ATCCTCAGCTCTTCCCTTACTTAATCAAGCCGCCGGGGATAGCGAAGAACAGGAATAAGG
 
. : . : . : . : . : . :
JMFN010B20+ AAACCCTGGATTAAGAAGGAGGAGAGAAATTAAAAAGGAGAATCTATCCAG
rJMSF029G14- AAACCCTGGATTAAGAAGGAGGAGAGAAATTAAAAAGGAGAATCTATCCAGGAATTCAGC
JMSF029G14+ AAACCCTGGATTAAGAAGGAGGAGAGAAATTAAAAAGGAGAATCTATCCAGGAATTCAGC
                      ____________________________________________________________
consensus AAACCCTGGATTAAGAAGGAGGAGAGAAATTAAAAAGGAGAATCTATCCAGGAATTCAGC
 
. : . : . : . : . : . :
rJMSF029G14- TGTGCACCAGGAAACGCTTG-CCCCCCGCCNAGCTGTCGTATTTATATGCGGGG
JMSF029G14+ TGTGCACCAGGAAACGCTTGCCCCCCCGCCCAGCTGTCGTATTTATATGCGGGGTGGTGC
                      ____________________________________________________________
consensus TGTGCACCAGGAAACGCTTGCCCCCCCGCCCAGCTGTCGTATTTATATGCGGGGTGGTGC
 
. : . : . : . : . : . :
JMSF029G14+ CTTGTGGAAATCAACGGCGGAACGTTACGTAGAGAGAGAAAACGGAGTTTTATACCCCGC
                      ____________________________________________________________
consensus CTTGTGGAAATCAACGGCGGAACGTTACGTAGAGAGAGAAAACGGAGTTTTATACCCCGC