Previous Contig 006583:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS095G06Sequence612006583 (2)gb:ATH404475_15525351e-12Arabidopsis thaliana partial mRNA for DNA Helicase (recQsim gene).>gb:AY059754_1
JMSF029G05Sequence664006583 (2)gb:ATH404475_15525351e-13Arabidopsis thaliana partial mRNA for DNA Helicase (recQsim gene).>gb:AY059754_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029G05+ ATTC
                      ____________________________________________________________
consensus ATTC
 
. : . : . : . : . : . :
JMFS095G06+ TGCTTCTGAAAACTTTTCAAGGAAGAAAACCCAAAGTGCTTG
JMSF029G05+ AACCAAGCTTCCAGAGANTGCTTCTGAAAACNTTTCAAGGAAGAAAACCCAAAGTGCTTG
                      ____________________________________________________________
consensus AACCAAGCTTCCAGAGANTGCTTCTGAAAACTTTTCAAGGAAGAAAACCCAAAGTGCTTG
 
. : . : . : . : . : . :
JMFS095G06+ ACCAACAAAGTTTTGACCTTCTTTTCCCAATCTTGGCCAAAGACCTCTTCATCTTTGCAA
JMSF029G05+ ACCAACAAAGTTTTGACCTTCTTTTCCCAATCTTGGCCAAAGACCTCTTCATCTTTGCAA
                      ____________________________________________________________
consensus ACCAACAAAGTTTTGACCTTCTTTTCCCAATCTTGGCCAAAGACCTCTTCATCTTTGCAA
 
. : . : . : . : . : . :
JMFS095G06+ TTCGATGGTACAGATGTTTCATGTGCATTGCACATATCAGTATCCATCACAGGAAGAAGC
JMSF029G05+ TTCGATGGTACAGATGTTTCATGTGCATTGCACATATCAGTATCCATCACAGGAAGAAGC
                      ____________________________________________________________
consensus TTCGATGGTACAGATGTTTCATGTGCATTGCACATATCAGTATCCATCACAGGAAGAAGC
 
. : . : . : . : . : . :
JMFS095G06+ TCAGTAGGACCTTCTAGGGTCCTCTGCAATGCCTCTGATTCACAGTGTGATACAGGTTCA
JMSF029G05+ TCAGTAGGACCTTCTAGGGTCCTCTGCAATGCCTCTGATTCACAGTGTGATACAGGTTCA
                      ____________________________________________________________
consensus TCAGTAGGACCTTCTAGGGTCCTCTGCAATGCCTCTGATTCACAGTGTGATACAGGTTCA
 
. : . : . : . : . : . :
JMFS095G06+ TCATTGTACTTCCTTTTTATAGGCTTGCAAGCTGATTTCAGGCATTCTTTTATATTAGAC
JMSF029G05+ TCATTGTACTTCCTTTTTATAGGCTTGCAAGCTGATTTCAGGCATTCTTTTATATTAGAC
                      ____________________________________________________________
consensus TCATTGTACTTCCTTTTTATAGGCTTGCAAGCTGATTTCAGGCATTCTTTTATATTAGAC
 
. : . : . : . : . : . :
JMFS095G06+ TGCCTCGTTCTATCAAAAGCAGGCAAGGCATTAGGGGCTCTTTTCTGCCTAGAATTGGTC
JMSF029G05+ TGCCTCGTTCTATCAAAAGCAGGCAAGGCATTAGGGGCTCTTTTCTGCCTAGAATTGGTC
                      ____________________________________________________________
consensus TGCCTCGTTCTATCAAAAGCAGGCAAGGCATTAGGGGCTCTTTTCTGCCTAGAATTGGTC
 
. : . : . : . : . : . :
JMFS095G06+ TTGGGGGCAACACATGTACTACTAGTTGATGTCCCCTTATTTCCATGTGAACCATCCAAT
JMSF029G05+ TTGGGGGCAACACATGTACTACTAGTTGATGTCCCCTTATTTCCATGTGAACCATCCAAT
                      ____________________________________________________________
consensus TTGGGGGCAACACATGTACTACTAGTTGATGTCCCCTTATTTCCATGTGAACCATCCAAT
 
. : . : . : . : . : . :
JMFS095G06+ ATATACTCAATTGCATGACTTACTGATGGACCAACTGCTTTTACAGCATCTGTAATATCA
JMSF029G05+ ATATACTCAATTGCATGACTTACTGATGGACCAACTGCTTTTACAGCATCTGTAATATCA
                      ____________________________________________________________
consensus ATATACTCAATTGCATGACTTACTGATGGACCAACTGCTTTTACAGCATCTGTAATATCA
 
. : . : . : . : . : . :
JMFS095G06+ GAGAATTCAAATCCCATTCCAACCAATTCAGCAATTACCTGGTCAGAAGCCATGTTCCCG
JMSF029G05+ GAGAATTCAAATCCCATTCCAACCAATTCAGCAATTACCTGGTCAGAAGCCATGTTCCCG
                      ____________________________________________________________
consensus GAGAATTCAAATCCCATTCCAACCAATTCAGCAATTACCTGGTCAGAAGCCATGTTCCCG
 
. : . : . : . : . : . :
JMFS095G06+ GAATAAACCTTGTGAAAACAATAGGAATTGGGGAGAGAGTGAACCCTAGAATCGAAGAAC
JMSF029G05+ GAATAAACCTTGTGAAAACAATAGGAATTGGGGAGAGAGTGAACCCTAGAATCGAAGAAC
                      ____________________________________________________________
consensus GAATAAACCTTGTGAAAACAATAGGAATTGGGGAGAGAGTGAACCCTAGAATCGAAGAAC
 
. : . : . : . : . : . :
JMFS095G06+ TTTAAACCCTGGCATTCGCAGTGTCC
JMSF029G05+ TTTAAACCCTGGCATTCGCAGTGTCCGATGCTCCGCGCCAAGAAGACTGTCTCGCCCCCA
                      ____________________________________________________________
consensus TTTAAACCCTGGCATTCGCAGTGTCCGATGCTCCGCGCCAAGAAGACTGTCTCGCCCCCA