Previous Contig 006577:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003E11Sequence459006577 (5)gb:AF190634_17754363e-33Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA669008265 (5)gb:AF190634_17754362e-63Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA
JMFN004F01Sequence627006577 (5)gb:AF190634_17754363e-52Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA
JMSF022H19Sequence685006577 (5)gb:AF190634_17754362e-52Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA754008265 (5)gb:AF190634_17754363e-84Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA
JMSF029E12Sequence691006577 (5)gb:AF190634_17754362e-52Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA781008265 (5)gb:AF190634_17754363e-88Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA
JMSF034H15Sequence691006577 (5)gb:AF190634_17754361e-53Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA703008265 (5)gb:AF190634_17754368e-75Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034H15+ CAGAATTGGTCCACTAGCAAATCCAAGACGAAGGGGT
JMFN004F01+ T
JMSF022H19+ GGTCCACTAGCAAATCCAAGACGAAGGGGT
JMSF029E12+ GGTCCACTAGCAAATCCAAGACGAAGGGGT
                      ____________________________________________________________
consensus CAGAATTGGTCCACTAGCAAATCCAAGACGAAGGGGT
 
. : . : . : . : . : . :
JMSF034H15+ ATGATTCAGGAGAATATATAAAAGACGGCATGTCTTTGGGCTCCAAACATGGCAACCCCG
JMFN004F01+ ATGATTCAGGAGAATATATAAAAGACGGCATGTCTTTGGGCTCCAAACATGGCAACCCCG
JMSF022H19+ ATGATTCAGGAGAATATATAAAAGACGGCATGTCTTTGGGCTCCAAACATGGCAACCCCG
JMSF029E12+ ATGATTCAGGAGAATATATAAAAGACGGCATGTCTTTGGGCTCCAAACATGGCAACCCCG
                      ____________________________________________________________
consensus ATGATTCAGGAGAATATATAAAAGACGGCATGTCTTTGGGCTCCAAACATGGCAACCCCG
 
. : . : . : . : . : . :
JMSF034H15+ GAATTTCAACCACTTCATCGTCGGCAAGAGGAAGTTTTAGCCGCCCCTGCTGTGTGTAAT
JMFN004F01+ GAATTTCAACCACTTCATCGTCGGCAAGAGGAAGTTTTAGCCGCCCCTGCTGTGTGTAAT
JMSF022H19+ GAATTTCAACCACTTCATCGTCGGCAAGAGGAAGTTTTAGCCGCCCCTGCTGTGTGTAAT
JMSF029E12+ GAATTTCAACCACTTCATCGTCGGCAAGAGGAAGTTTTAGCCGCCCCTGCTGTGTGTAAT
                      ____________________________________________________________
consensus GAATTTCAACCACTTCATCGTCGGCAAGAGGAAGTTTTAGCCGCCCCTGCTGTGTGTAAT
 
. : . : . : . : . : . :
JMSF034H15+ AGTAAATCGCATCCACCGCACACGACTGCGTAAAGAAACAGCCACCGGAAACTCCCTCCT
JMFN004F01+ AGTAAATCGCATCCACCGCACACGACTGCGTAAAGAAACAGCCACCGGAAACTCCCTCCT
JMSF022H19+ AGTAAATCGCATCCACCGCACACGACTGCGTAAAGAAACAGCCACCGGAAACTCCCTCCT
JMSF029E12+ AGTAAATCGCATCCACCGCACACGACTGCGTAAAGAAACAGCCACCGGAAACTCCCTCCT
                      ____________________________________________________________
consensus AGTAAATCGCATCCACCGCACACGACTGCGTAAAGAAACAGCCACCGGAAACTCCCTCCT
 
. : . : . : . : . : . :
JMSF034H15+ CGACCGCCACGTCCAAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
JMFN004F01+ CGACCGCCACGTCCAAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
JMFF003E11+ AAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
JMSF022H19+ CGACCGCCACGTCCAAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
JMSF029E12+ CGACCGCCACGTCCAAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
                      ____________________________________________________________
consensus CGACCGCCACGTCCAAAACCCATGGCAAAAACGCGTCATAGACGACGCAGCTGACCGGAA
 
. : . : . : . : . : . :
JMSF034H15+ ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
JMFN004F01+ ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
JMFF003E11+ ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
JMSF022H19+ ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
JMSF029E12+ ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
                      ____________________________________________________________
consensus ACCGCCCAACACGGAGGCGACGGAGAACTTGCGCCAACGTCTCGGAGCCGACTTGTCGGA
 
. : . : . : . : . : . :
JMSF034H15+ ATTTATCGATGTAAGCTTGACTGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
JMFN004F01+ ATTTATCGATGTAAGCTTGAATGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
JMFF003E11+ ATTTATCGATGTAAGCTTGACTGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
JMSF022H19+ ATTTATCGATGTAAGCTTGACTGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
JMSF029E12+ ATTTATCGATGTAAGCTTGACTGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
                      ____________________________________________________________
consensus ATTTATCGATGTAAGCTTGACTGCTCCGGGTATGAGAAGGGACGCCCTCGTCGAAGCCGT
 
. : . : . : . : . : . :
JMSF034H15+ CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
JMFN004F01+ CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
JMFF003E11+ CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
JMSF022H19+ CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
JMSF029E12+ CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
                      ____________________________________________________________
consensus CGGAGATGGTTTCAATGGAGAGGTGGGTGCTTGAGAGGTCCTGCAGGGTTGCTAACAAGA
 
. : . : . : . : . : . :
JMSF034H15+ ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
JMFN004F01+ ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
JMFF003E11+ ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
JMSF022H19+ ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
JMSF029E12+ ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
                      ____________________________________________________________
consensus ACTTGGTTACAGCTATGGTGATCTTCACTCCTTTGGCTTCTAATCGCTTGGAGAATTGAA
 
. : . : . : . : . : . :
JMSF034H15+ GCATGGGGTTTATGTGGCCCTGGGCTGGATATGGCAATATGAGGCAGTGAACCACCTTGT
JMFN004F01+ GCATGGGGTTTATGTGGCCCTGGGCTGGATATGGCAATATGAGGCAGTGAACCACCTTGT
JMFF003E11+ GCATGGGGTTTATGTGGCCCTGGGCTGGGTATGGCAATATGAGGCAGTGAACCACCTTGT
JMSF022H19+ GCATGGGGTTTATGTGGCCCTGGGCTGGATATGGCAATATGAGGCAGTGAACCACCTTGT
JMSF029E12+ GCATGGGGTTTATGTGGCCCTGGGCTGGATATGGCAATATGAGGCAGTGAACCACCTTGT
                      ____________________________________________________________
consensus GCATGGGGTTTATGTGGCCCTGGGCTGGATATGGCAATATGAGGCAGTGAACCACCTTGT
 
. : . : . : . : . : . :
JMSF034H15+ ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
JMFN004F01+ ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
JMFF003E11+ ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
JMSF022H19+ ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
JMSF029E12+ ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
                      ____________________________________________________________
consensus ATTGATTATCATTATCTTCCTCATCATGCTTTTGATTTCCCCTTTCATGGTTCTCCATCT
 
. : . : . : . : . : . :
JMSF034H15+ CAATCTCTGTAAATGGACGGAGCATAGAACAGAGAAAACCCCACTATTTTC
JMFN004F01+ CAATCTCTGTAAATGGACGGAGCATA
JMFF003E11+ CAATCTCTGTAAATGGACGGAGCATAGAACAGAGAAAACCCCACTATTTTC
JMSF022H19+ CAATCTCTGTAAATGGACGGAGCATAGAACAGAGAAAACCCCACTATTTTC
JMSF029E12+ CAATCTCTGTAAATGGACGGAGCATAGAACAGAGAAAACCCCACTATTTTCCTGCTCCAA
                      ____________________________________________________________
consensus CAATCTCTGTAAATGGACGGAGCATAGAACAGAGAAAACCCCACTATTTTCCTGCTCCAA