Previous Contig 006572:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O09Sequence479006572 (19)pir|A84473|A844735e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294653010719 (19)pir|A84473|A844733e-50probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF004O12Sequence517006572 (19)pir|A84473|A844734e-23probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294635010719 (19)pir|A84473|A844732e-55probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF014O15Sequence510006572 (19)pir|A84473|A844735e-23probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294712010719 (19)pir|A84473|A844731e-68probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF019D14Sequence584006572 (19)pir|A84473|A844735e-27probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294714010719 (19)pir|A84473|A844735e-71probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF028J09Sequence569006572 (19)pir|A84473|A844731e-45probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294588010719 (19)pir|A84473|A844736e-56probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF034N23Sequence441006572 (19)pir|A84473|A844731e-13probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294490010719 (19)pir|A84473|A844731e-38probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF037L08Sequence567006572 (19)pir|A84473|A844733e-25probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294521010719 (19)pir|A84473|A844733e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF037N20Sequence492006572 (19)pir|A84473|A844733e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294750010719 (19)pir|A84473|A844736e-53probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF041J20Sequence643006572 (19)pir|A84473|A844734e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294616010719 (19)pir|A84473|A844734e-47probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFF047E01Sequence497006572 (19)pir|A84473|A844731e-37probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294503010719 (19)pir|A84473|A844735e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS001D01Sequence616006572 (19)pir|A84473|A844731e-33probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS007C11Sequence580006572 (19)pir|A84473|A844733e-31probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS012F06Sequence595006572 (19)pir|A84473|A844732e-45probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS016H10Sequence604006572 (19)pir|A84473|A844736e-32probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS049F08Sequence611006572 (19)pir|A84473|A844739e-34probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS076F05Sequence660006572 (19)pir|A84473|A844733e-40probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMFS163D04Sequence617006572 (19)pir|A84473|A844736e-32probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMSF028F14Sequence669006572 (19)pir|A84473|A844734e-40probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294742010719 (19)pir|A84473|A844734e-83probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294
JMSF029D08Sequence648006572 (19)pir|A84473|A844731e-35probable serine proteinase [imported] - Arabidopsis thaliana>gb:AC005970_1533294

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF028J09+ CTGGTGTAGAATCGAG
JMFS012F06+ AGCCTCTGGTGTAGAATCGAG
                      ____________________________________________________________
consensus AGCCTCTGGTGTAGAATCGAG
 
. : . : . : . : . : . :
JMFF047E01+ CATC
JMFF028J09+ CGCCGATGAGCTTTTTATTGCAGTGGGTTTTCGGGTCGAAATTCGGGGCGGATTCGCATC
JMFS012F06+ CGCCGATGAGCTTTTTATGNCAGTGGGTTTTCGGGTCGAAATTCGGGGCGGATTCGCATC
JMFS076F05+ CGGGTCGAAATTCGGGGCGGATTCGCATC
JMSF028F14+ GGGCGGATTCGCATC
                      ____________________________________________________________
consensus CGCCGATGAGCTTTTTATTGCAGTGGGTTTTCGGGTCGAAATTCGGGGCGGATTCGCATC
 
. : . : . : . : . : . :
JMFF047E01+ GGCCGCGCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMFF037N20+ GCCGCGCCACNTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMFF028J09+ GGCCGCGCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMFF002O09+ GCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTNTTTGANTCCG
JMFS012F06+ GGCCGCGCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMFS076F05+ GGCCGCGCCACCTCGCGGGCACAGCCGTCATGCCGGAATCGTCAAGCTTCTTTGACTCCG
JMFS016H10+ TCATGCCGGAATCGTCAAAGCTC-TTGACTCCG
JMFS163D04+ GGCACAGCCGTCATGCCGGAATCGTCAAAGCTC-TTGACTCAG
JMFS001D01+ TCATGCCGGAATCGTCAAAGCTCTTTGACTCGG
JMFS049F08+ TCATGCCGGAATCGTCANAGCTCTTTGACTCGG
JMFS007C11+ TTGACTCCG
JMFF041J20+ GCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMSF028F14+ GGCCGCGCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
JMSF029D08+ TCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
                      ____________________________________________________________
consensus GGCCGCGCCACCTCGCCGGCACAGCCGTCATGCCGGAATCGTCAAAGCTCTTTGACTCCG
 
. : . : . : . : . : . :
JMFF047E01+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF037N20+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF028J09+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF002O09+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS012F06+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS076F05+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS016H10+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS163D04+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS001D01+ CCCACACNCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS049F08+ GCCACACNCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFS007C11+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF041J20+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF019D14+ GGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMSF028F14+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMFF037L08+ GATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
JMSF029D08+ GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCNTCCGGCGAGCCGTGGC
                      ____________________________________________________________
consensus GCCACACCCCGGTATCCAGAATCCCCACGATTACGTCCGCCGCCTCCGGCGAGCCGTGGC
 
. : . : . : . : . : . :
JMFF047E01+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF037N20+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF028J09+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF002O09+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS012F06+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS076F05+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS016H10+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS163D04+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS001D01+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS049F08+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFS007C11+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF041J20+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF019D14+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMSF028F14+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF037L08+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF014O15+ CAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMFF004O12+ GCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
JMSF029D08+ CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
                      ____________________________________________________________
consensus CCGCCCCAAGCCCGAACTCCGCATCCAGCCCTAGAAACTCAGGCGTACGGGTCGTGTGCA
 
. : . : . : . : . : . :
JMFF047E01+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCAACCGCCGGAGCCGCTCCA
JMFF037N20+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCAACCGCCGGAGCCGCTCCA
JMFF028J09+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCAACCGCCGGAGCCGCTCCA
JMFF002O09+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCAACCGCCGGAGCCGCTCCA
JMFS012F06+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS076F05+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS016H10+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS163D04+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS001D01+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS049F08+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFS007C11+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFF041J20+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFF019D14+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMSF028F14+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFF037L08+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFF014O15+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMFF034N23+ CGCCTCCGACCGCCGGAGCCGCTCCA
JMFF004O12+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
JMSF029D08+ AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
                      ____________________________________________________________
consensus AACTGTACACTGAATCCTCATACACACCAACCACCGCCTCCGACCGCCGGAGCCGCTCCA
 
. : . : . : . : . : . :
JMFF047E01+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF037N20+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF028J09+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF002O09+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS012F06+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS076F05+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS016H10+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS163D04+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS001D01+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS049F08+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFS007C11+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF041J20+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF019D14+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMSF028F14+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF037L08+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF014O15+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF034N23+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMFF004O12+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
JMSF029D08+ CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
                      ____________________________________________________________
consensus CCTCGTCGGCGCCTAATGCGGCGGCGAAGCCGTGATAGGCGGTGGTGTAGGTGTACAAAA
 
. : . : . : . : . : . :
JMFF047E01+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF037N20+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF028J09+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF002O09+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS012F06+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS076F05+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS016H10+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS163D04+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS001D01+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS049F08+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFS007C11+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF041J20+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF019D14+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMSF028F14+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF037L08+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF014O15+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF034N23+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMFF004O12+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
JMSF029D08+ GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
                      ____________________________________________________________
consensus GGGAGTCCTCCGAGGATTGGAGATGGGCAGCGTACCAATCCCGGTGGGTTTGGAATGAAG
 
. : . : . : . : . : . :
JMFF047E01+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF037N20+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF028J09+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF002O09+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS012F06+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS076F05+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS016H10+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS163D04+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS001D01+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS049F08+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFS007C11+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF041J20+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF019D14+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMSF028F14+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF037L08+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF014O15+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF034N23+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMFF004O12+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
JMSF029D08+ AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
                      ____________________________________________________________
consensus AAGGCTTTTCGTGATGTTTCATGTGTACGATGTATGTTTTCTTCGCCACTGCCGCGGTCG
 
. : . : . : . : . : . :
JMFF047E01+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF037N20+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF028J09+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF002O09+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS012F06+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS076F05+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS016H10+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS163D04+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS001D01+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS049F08+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFS007C11+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF041J20+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF019D14+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMSF028F14+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF037L08+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF014O15+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF034N23+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMFF004O12+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
JMSF029D08+ CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
                      ____________________________________________________________
consensus CCGCACATGGTCGGAGGAGATGGAGGAGGATAGTAATGGCTGAGAACCAAACCAGAGAAC
 
. : . : . : . : . : . :
JMFF047E01+ CCATTGCTCAAAT
JMFF037N20+ CCATTGCTCAAAT
JMFF028J09+ CCATTGCTCAAAT
JMFF002O09+ CCATTGCTCAAAT
JMFS012F06+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTT
JMFS076F05+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFS016H10+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFS163D04+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFS001D01+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFS049F08+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFS007C11+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF041J20+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF019D14+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMSF028F14+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF037L08+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF014O15+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF034N23+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMFF004O12+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
JMSF029D08+ CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
                      ____________________________________________________________
consensus CCATTGCTCAAATGGAAGACAAGAATGAGGTTTTGGAGAGTATAATGAGAGATTTTCGAT
 
. : . : . : . : . : . :
JMFS076F05+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFS016H10+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFS163D04+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFS001D01+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFS049F08+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFS007C11+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF041J20+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF019D14+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMSF028F14+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF037L08+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF014O15+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF034N23+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMFF004O12+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
JMSF029D08+ TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
                      ____________________________________________________________
consensus TTATACTAACATCTGTGGGAGATATATATATAAATATACTGGTACACCTACATATACGTA
 
. : . : . : . : . : . :
JMFS076F05+ TAGATTATAGAGTGAGCTAGCAAGCTGT
JMFS016H10+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGC
JMFS163D04+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAG
JMFS001D01+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGT
JMFS049F08+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAA
JMFS007C11+ TAGATTATAGAGTGAGCTAGCAAGCTGT
JMFF041J20+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTG
JMFF019D14+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGT
JMSF028F14+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGAC
JMFF037L08+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTT
JMFF014O15+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTT
JMFF034N23+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTT
JMFF004O12+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTT
JMSF029D08+ TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTTCCACC
                      ____________________________________________________________
consensus TAGATTATAGAGTGAGCTAGCAAGCTGTGAGCTAGCAAGCTGTGAGCTGTGACTTCCACC