Previous Contig 006571:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024P12Sequence644006571 (2)sp|O22493|GSH1_LYCES2e-48Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc785012383 (2)sp|O22493|GSH1_LYCES1e-59Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc
JMSF029C21Sequence647006571 (2)sp|O22493|GSH1_LYCES2e-48Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc687012383 (2)gb:AB158510_15284062e-46Zinnia elegans ZeGSH1 mRNA for gamma-glutamylcysteine synthetase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024P12+ CCAATCAAATCTCTCGGCAATACCATTAAGCAACTCAGCTATTTGT
JMSF029C21+ CCCAATCAAATCTCTCGGCAATACCATTAAGCAACTCAGCTATTTGT
                      ____________________________________________________________
consensus CCCAATCAAATCTCTCGGCAATACCATTAAGCAACTCAGCTATTTGT
 
. : . : . : . : . : . :
JMSF024P12+ GCATACTTCATGGGCCGCAAAGTTCCAAACTCAAAACCAAACTTTTCATGCTCTGTGCCT
JMSF029C21+ GCATACTTCATGGGCCGCAAAGTTCCAAACTCAAAACCAAACTTTTCATGCTCTGTGCCT
                      ____________________________________________________________
consensus GCATACTTCATGGGCCGCAAAGTTCCAAACTCAAAACCAAACTTTTCATGCTCTGTGCCT
 
. : . : . : . : . : . :
JMSF024P12+ ATCCTCCATTTTTCCTTAGGCTTGCAGCCAGAAGTAAGGTAATCAATCAGATCTTTCTTC
JMSF029C21+ ATCCTCCATTTTTCCTTAGGCTTGCAGCCAGAAGTAAGGTAATCAATCAGATCTTTCTTC
                      ____________________________________________________________
consensus ATCCTCCATTTTTCCTTAGGCTTGCAGCCAGAAGTAAGGTAATCAATCAGATCTTTCTTC
 
. : . : . : . : . : . :
JMSF024P12+ GTTAGCGGCTCTGTGGAAACAACAGCATCCTCAGTTGGAGGACTTGCAGCAACAATAAGC
JMSF029C21+ GTTAGCGGCTCTGTGGAAACAACAGCATCCTCAGTTGGAGGACTTGCAGCAACAATAAGC
                      ____________________________________________________________
consensus GTTAGCGGCTCTGTGGAAACAACAGCATCCTCAGTTGGAGGACTTGCAGCAACAATAAGC
 
. : . : . : . : . : . :
JMSF024P12+ CCGTGTCGTCGCCTATATCCTGCTCCAATGCAATTCGAACGCAAGCCTTGAACTGCCTGT
JMSF029C21+ CCGTGTCGTCGCCTATATCCTGCTCCAATGCAATTCGAACGCAAGCCTTGAACTGCCTGT
                      ____________________________________________________________
consensus CCGTGTCGTCGCCTATATCCTGCTCCAATGCAATTCGAACGCAAGCCTTGAACTGCCTGT
 
. : . : . : . : . : . :
JMSF024P12+ GATGAATTCCATGAAGAGAAATTCAAACCAAAACTCATTTCCTTCATTCTATATGCCTCT
JMSF029C21+ GATGAATTCCATGAAGAGAAATTCAAACCAAAACTCATTTCCTTCATTCTATATGCCTCT
                      ____________________________________________________________
consensus GATGAATTCCATGAAGAGAAATTCAAACCAAAACTCATTTCCTTCATTCTATATGCCTCT
 
. : . : . : . : . : . :
JMSF024P12+ AAATTATTCCCACTGTTAGTACATCCAGCTTCGCATCTTATCATTTCACAATGCAACGAT
JMSF029C21+ AAATTATTCCCACTGTTAGTACATCCAGCTTCGCATCTTATCATTTCACAATGCAACGAT
                      ____________________________________________________________
consensus AAATTATTCCCACTGTTAGTACATCCAGCTTCGCATCTTATCATTTCACAATGCAACGAT
 
. : . : . : . : . : . :
JMSF024P12+ GACCCTGCCATGGACATCAACGCCATGGCTTTTTACCTTAGTTAAGCAACCCAGAGACCG
JMSF029C21+ GACCCTGCCATGGACATCAACGCCATGGCTTTTTACCTTAGTTAAGCAACCCAGAGACCG
                      ____________________________________________________________
consensus GACCCTGCCATGGACATCAACGCCATGGCTTTTTACCTTAGTTAAGCAACCCAGAGACCG
 
. : . : . : . : . : . :
JMSF024P12+ AAAATTCTGGGATTTGCTCTTGCAGATTGACGGTGATAAAAAGAAAATGAGACGTATATG
JMSF029C21+ AAAATTCTGGGATTTGCTCTTGCAGATTGACGGTGATAAAAAGAAAATGAGACGTATATG
                      ____________________________________________________________
consensus AAAATTCTGGGATTTGCTCTTGCAGATTGACGGTGATAAAAAGAAAATGAGACGTATATG
 
. : . : . : . : . : . :
JMSF024P12+ AGAAGACTAGTAAAATTAAATGTGCCGTTTTCTGCTAGTTTGGTCCTTTTTCTTCTCTCT
JMSF029C21+ AGAAGACTAGTAAAATTAAATGTGCCGTTTTCTGCTAGTTTGGTCCTTTTTCTTCTCTCT
                      ____________________________________________________________
consensus AGAAGACTAGTAAAATTAAATGTGCCGTTTTCTGCTAGTTTGGTCCTTTTTCTTCTCTCT
 
. : . : . : . : . : . :
JMSF024P12+ TCTCTTCCCAAAGTCCTCTTTCTTCTCTTGCACTGTGAGATGACGCCGGAGCGAAGCC
JMSF029C21+ TCTCTTCCCAAAGTCCTCTTTCTTCTCTTGCACTGTGAGATGACGCCGGAGCGAAGCCCC
                      ____________________________________________________________
consensus TCTCTTCCCAAAGTCCTCTTTCTTCTCTTGCACTGTGAGATGACGCCGGAGCGAAGCCCC