Previous Contig 006561:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS035D10Sequence592006561 (4)gb:AC027036_15398112e-08Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete sequence.
JMFS081A03Sequence599006561 (4)gb:AC027036_15398112e-08Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete sequence.
JMSF029B02Sequence676006561 (4)sp|Q9C646|R24L_ARATH2e-13Probable disease resistance protein RXW24L.>pir|H96617|H96617 probable disease r735013727 (2)gb:STU249449_17230072e-20Solanum tuberosum GPA2 gene for NBS-LRR protein, exons 1-3.>gb:AF195939_1775942
JMSF047K02Sequence687006561 (4)gb:CAR298885_16452252e-31Coffea arabica partial ORF for disease resistance-like protein, clone NBS ArgaB1759013727 (2)gb:AB120525_15279671e-20Nicotiana tabacum HMA8 mRNA for hypothetical protein, partial cds, clone: KM10.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047K02+ AAACTTTCATCATGGNTCAGAAACTTCA
                      ____________________________________________________________
consensus AAACTTTCATCATGGNTCAGAAACTTCA
 
. : . : . : . : . : . :
JMSF047K02+ GGTCGTGAGGCTGACCATTAGAAGTGGCACGCGATGCCACATTGCCCTGACGGGTAGTTA
                      ____________________________________________________________
consensus GGTCGTGAGGCTGACCATTAGAAGTGGCACGCGATGCCACATTGCCCTGACGGGTAGTTA
 
. : . : . : . : . : . :
JMSF047K02+ ACAACACTCGACTTTTCTTCTTGTTGTTGGGGAAAGCTATTTTCAAAAGCTTCCAGTCTT
                      ____________________________________________________________
consensus ACAACACTCGACTTTTCTTCTTGTTGTTGGGGAAAGCTATTTTCAAAAGCTTCCAGTCTT
 
. : . : . : . : . : . :
JMSF047K02+ TTTCTTCCCACACATCATCAAGCACAATCAAGTACTTTCCACTCTCCAAGAACTTGCTTA
                      ____________________________________________________________
consensus TTTCTTCCCACACATCATCAAGCACAATCAAGTACTTTCCACTCTCCAAGAACTTGCTTA
 
. : . : . : . : . : . :
JMSF047K02+ TTTTTTCAGCCAATTGCTCTTCGGTCATATCGTGGTAGTCCTTGGTGCGTTGGGTGAAAA
                      ____________________________________________________________
consensus TTTTTTCAGCCAATTGCTCTTCGGTCATATCGTGGTAGTCCTTGGTGCGTTGGGTGAAAA
 
. : . : . : . : . : . :
JMSF047K02+ TGCTCAGTATGTTGAGAAATATGTCCTTCCTATTGTAAGACCGCGAAACATAAACCCAAT
                      ____________________________________________________________
consensus TGCTCAGTATGTTGAGAAATATGTCCTTCCTATTGTAAGACCGCGAAACATAAACCCAAT
 
. : . : . : . : . : . :
JMSF047K02+ GGCGAGTAAAGAACTCATATTCAATCTCAGAATCCTTGAACACTTTTCTAGCTAATGTGG
JMSF029B02+ TTTCTAGCTAATGTGG
                      ____________________________________________________________
consensus GGCGAGTAAAGAACTCATATTCAATCTCAGAATCCTTGAACACTTTTCTAGCTAATGTGG
 
. : . : . : . : . : . :
JMSF047K02+ TTTTACCAAGACCAGGCATGCCAAAGATCGAGACGACTTCTAAGTCATCCGATCCCCCAA
JMFS081A03+ GTCATCCGATCCCCCAA
JMFS035D10+ GTCATCCGATCCCCCAA
JMSF029B02+ TTTTACCAAGACCAGGCATGCCAAAGATCGAGACGACTTCTAAGTCATCCGATCCCCCAA
                      ____________________________________________________________
consensus TTTTACCAAGACCAGGCATGCCAAAGATCGAGACGACTTCTAAGTCATCCGATCCCCCAA
 
. : . : . : . : . : . :
JMSF047K02+ TCAGACGATCAATTATGGTCTTTGCCTCTCCATCAAACCCCACAACATCATCTTCTTCAA
JMFS081A03+ TCAGACGATCAATTATGGTCTTTGCCTCTCCATCAAACCCCACAACATCATCTTCTTCAA
JMFS035D10+ TCGGACGATCAATTATGGTCTTTGCCTCTCCATCAAACCCCACAACATCATCTTCTTCAA
JMSF029B02+ TCAGACGATCAATTATGGTCTTTGCCTCTCCATCAAACCCCACAACATCATCTTCTTCAA
                      ____________________________________________________________
consensus TCAGACGATCAATTATGGTCTTTGCCTCTCCATCAAACCCCACAACATCATCTTCTTCAA
 
. : . : . : . : . : . :
JMSF047K02+ CCACCGGAGCCTTTCTC---GCAGCATCTTTGGATGCATTATCCATCTGCAAAGCTTGAA
JMFS081A03+ CCACCGGAGCCTTTCTCTCTGCAGCATCTTTGGATGCATTATCCATCTGCAAAGCTTGAA
JMFS035D10+ CCACCGGAGCCTTTCTCTCTGCAGCATCTTTGGATGCATTATCCATCTGCAAAGCTTGAA
JMSF029B02+ CCACCGGAGCCTTTCTCTCTGCAGCATCTTTGGATGCATTATCCATCTGCAAAGCTTGAA
                      ____________________________________________________________
consensus CCACCGGAGCCTTTCTCTCTGCAGCATCTTTGGATGCATTATCCATCTGCAAAGCTTGAA
 
. : . : . : . : . : . :
JMSF047K02+ GGCCATAGGCATTATTCTGGCGAATCGCCCTCACTTCATTCCTTATAGATTCAATCTCTC
JMFS081A03+ GGCCATAGGCATTATTCTGGCGAATCGCCCTCACTTCATTCCTTATAGATTCAATCTCTC
JMFS035D10+ GGCCATAGGCATTATTCTGGCGAATCGCCCTCACTTCATTCCTTATAGATTCAATCTCTC
JMSF029B02+ GGCCATAGGCATTATTCTGGCGAATCGCCCTCACTTCATTCCTTATAGATTCAATCTCTC
                      ____________________________________________________________
consensus GGCCATAGGCATTATTCTGGCGAATCGCCCTCACTTCATTCCTTATAGATTCAATCTCTC
 
. : . : . : . : . : . :
JMSF047K02+ TTGCGGCGGCGTTGACTTTGACCAGGTGAGCCGGTTTATCCACGTACCGGGTCATCATCC
JMFS081A03+ TTGCGGCGGCGTTGACTTTGACCAGGTGAGCCGGTTTATCCACGTACCGGGTCATCATCC
JMFS035D10+ TTGCGGCGGCGTTGACTTTGACCAGGTGAGCCGGTTTATCCACGTACCGGGTCATCATCC
JMSF029B02+ TTGCGGCGGCGTTGACTTTGACCAGGTGAGCCGGTTTATCCACGTACCGGGTCATCATCC
                      ____________________________________________________________
consensus TTGCGGCGGCGTTGACTTTGACCAGGTGAGCCGGTTTATCCACGTACCGGGTCATCATCC
 
. : . : . : . : . : . :
JMFS081A03+ CTTTGGACCGGTGGAGCTTCGCCTCCACCACGAACTTGTCGATGGCGTCCTCCGCCTTGT
JMFS035D10+ CTTTGGACCGGTGGAGCTTCGCCTCCACCACGAACTTGTCGATGGCGTCCTCCGCCTTGT
JMSF029B02+ CTTTGGACCGGTGGAGCTTCGCCTCCACCACGAACTTGTCGATGGCGTCCTCCGCCTTGT
                      ____________________________________________________________
consensus CTTTGGACCGGTGGAGCTTCGCCTCCACCACGAACTTGTCGATGGCGTCCTCCGCCTTGT
 
. : . : . : . : . : . :
JMFS081A03+ TCACGGCGATCCTGATCTTCTTCACCAGCTCCTTGATCACCTCGTTCTGGCTGCGCCGCC
JMFS035D10+ TCACGGCGATCCTGATCTTCTTCACCAGCTCCTTGATCACCTCGTTCTGGCTGCGCCGCC
JMSF029B02+ TCACGGCGATCCTGATCTTCTTCACCAGCTCCTTGATCACCTCGTTCTGGCTGCGCCGCC
                      ____________________________________________________________
consensus TCACGGCGATCCTGATCTTCTTCACCAGCTCCTTGATCACCTCGTTCTGGCTGCGCCGCC
 
. : . : . : . : . : . :
JMFS081A03+ GCGCCGCCTCCTTGAGGAACGCCTTGAAGTCGCCCAGGTCGCCCAGGAGGCTCTCCGCTT
JMFS035D10+ GCGCCGCCTCCTTGAGGAACGCCTTGAAGTCGCCCAGGTCGCCCAGGAGGCTCTCCGCTT
JMSF029B02+ GCGCCGCCTCCTTGAGGAACGCCTTGAAGTCGCCCAGGTCGCCCAGGAGGCTCTCCGCTT
                      ____________________________________________________________
consensus GCGCCGCCTCCTTGAGGAACGCCTTGAAGTCGCCCAGGTCGCCCAGGAGGCTCTCCGCTT
 
. : . : . : . : . : . :
JMFS081A03+ GCTCCTTTATTCCGAAGATGAGCTCCGCGTTGTCCCGGAGGAGCTGTAGAAGATTCTCCA
JMFS035D10+ GCTCCTTTATTCCGAAGATGAGCTCCGCGTTGTCCCGGAGGAGCTGTAGAAGATTCTCCA
JMSF029B02+ GCTCCTTTATTCCGAAGATGAGCTCCGCGTTGTCCCGGAGGAGCTGTAGAAGATTCTCCA
                      ____________________________________________________________
consensus GCTCCTTTATTCCGAAGATGAGCTCCGCGTTGTCCCGGAGGAGCTGTAGAAGATTCTCCA
 
. : . : . : . : . : . :
JMFS081A03+ CCAGGAACTGCACGGCCGCGTCCGCCATGGCTGGGGATCTGCGGCGGCGAGAGGCTCAGG
JMFS035D10+ CCAGGAACTGCACGGCCGCGTCCGCCATGGCTGGGGATCTGCGGCGGCGAGAGGCTCAGG
JMSF029B02+ CCAGGAACTGCACGGCCGCGTCCGCCATGGCTGGGGATCTGCGGCGGCGAGAGGCTCAGG
                      ____________________________________________________________
consensus CCAGGAACTGCACGGCCGCGTCCGCCATGGCTGGGGATCTGCGGCGGCGAGAGGCTCAGG
 
. : . : . : . : . : . :
JMFS081A03+ AACGTTGACTGAAAGTCTACTTCTTGTTTCTTGGTCTTTGGT
JMFS035D10+ AACGTTGACTGAAAGTCTACTTCTTGTTTCTTG
JMSF029B02+ AACGTTGACTGAAAGTCTACTTCTTGTTTCTTGGTCTTTGGTGATGGAGTGGGAATAATC
                      ____________________________________________________________
consensus AACGTTGACTGAAAGTCTACTTCTTGTTTCTTGGTCTTTGGTGATGGAGTGGGAATAATC