Previous Contig 006559:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010D14Sequence549006559 (4)gb:AE005172_8919357e-63Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC004135_153143686008641 (3)gb:AB024033_15157805e-19Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AC069474_154
JMFF032I19Sequence478006559 (4)gb:AC104284_17375045e-44Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete s654008641 (3)gb:AB024033_15157805e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AC069474_154
JMFS147C10Sequence627006559 (4)gb:AP003709_18322527e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF029A20Sequence667006559 (4)gb:AP003709_18322524e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN689008641 (3)gb:AB024033_15157803e-23Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AC069474_154

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010D14+ CTTT
                      ____________________________________________________________
consensus CTTT
 
. : . : . : . : . : . :
JMFF010D14+ TCCATCAACAGGAATGACTGCTACGCGTTCAATCCATTCTTGAATGGCATCTGTTATGTG
                      ____________________________________________________________
consensus TCCATCAACAGGAATGACTGCTACGCGTTCAATCCATTCTTGAATGGCATCTGTTATGTG
 
. : . : . : . : . : . :
JMFF032I19+ AACCTGAACAGTGGTTCCCAAATAATCTCCTCTTCTCTCCTTATCAATAACAGC
JMFF010D14+ AGGGACAACCTGAACAGTGGTTCCCAAATAATCTCCTCTTCTCTCCTTATCAATAACAGC
                      ____________________________________________________________
consensus AGGGACAACCTGAACAGTGGTTCCCAAATAATCTCCTCTTCTCTCCTTATCAATAACAGC
 
. : . : . : . : . : . :
JMFF032I19+ CTGGTAAATTTTTCCAGTAGTTATGTTGTTGTCACGTGTTAGCTTAATATCTAGGAAACG
JMFF010D14+ CTGGTAAATTTTTCCAGTAGTTATGTTGTTGTCACGTGTTAGCTTAATATCTAGGAAACG
JMFS147C10+ TAGTTATGTTGTTGTCACGTGTTAGCTTAATATCTAGGAAACG
JMSF029A20+ TGGTAAATTTTTCCAGTAGTTATGTTGTTGTCACGTGTTAGCTTAATATCTAGGAAACG
                      ____________________________________________________________
consensus CTGGTAAATTTTTCCAGTAGTTATGTTGTTGTCACGTGTTAGCTTAATATCTAGGAAACG
 
. : . : . : . : . : . :
JMFF032I19+ TTCATAGTTCCCAAGATCAAGGTCAACCTCACCA-CCATCATCCAGGACATATACTTCTC
JMFF010D14+ TTCATAGTTCCCAAGATCAAGGTCAACCTCACCACCCATCATCCAGGACATATACTTCTC
JMFS147C10+ TTCATAGTTCCCAAGATCAAGGTCAACCTCACCA-CCATCATCCAGGACATATACTTCTC
JMSF029A20+ TTCATAGTTCCCAAGATCAAGGTCAACCTCACCA-CCATCATCCAGGACATATACTTCTC
                      ____________________________________________________________
consensus TTCATAGTTCCCAAGATCAAGGTCAACCTCACCA-CCATCATCCAGGACATATACTTCTC
 
. : . : . : . : . : . :
JMFF032I19+ CATGCTCAAAAGGAGACATAGTTCCAGCATCAGTATTCAAGTAAGGATCAATTTTAATGT
JMFF010D14+ CATGCTCAAAAGGAGACATAGTTCCAGCATCAGTATTCAAGTAAGGATCAATTTTAATGT
JMFS147C10+ CATGCTCAAAAGGAGACATAGTTCCAGCATCAGTATTCAAGTAAGGATCAATTTTAATGT
JMSF029A20+ CATGCTCAAAAGGAGACATAGTTCCAGCATCAGTATTCAAGTAAGGATCAATTTTAATGT
                      ____________________________________________________________
consensus CATGCTCAAAAGGAGACATAGTTCCAGCATCAGTATTCAAGTAAGGATCAATTTTAATGT
 
. : . : . : . : . : . :
JMFF032I19+ GAGTAACTCGAAGTCCGCAGGCCTTAAGGATGAGGCCAATACTGCTAGCAGTGACTCCTT
JMFF010D14+ GAGTAACTCGAAGTCCGCAGGCCTTAAGGATGAGGCCAATACTGCTAGCAGTGACTCCTT
JMFS147C10+ GAGTAACTCGAAGTCCGCAGGCCTTAAGGATGAGGCCAATACTGCTAGCAGTGACTCCTT
JMSF029A20+ GAGTAACTCGAAGTCCGCAGGCCTTAAGGATGAGGCCAATACTGCTAGCAGTGACTCCTT
                      ____________________________________________________________
consensus GAGTAACTCGAAGTCCGCAGGCCTTAAGGATGAGGCCAATACTGCTAGCAGTGACTCCTT
 
. : . : . : . : . : . :
JMFF032I19+ TCCCGAGCCCGCTCACCACACCTCCGGTAACCAATATGTATTTCATTCTCGATCCTCTTT
JMFF010D14+ TCCCGAGCCCGCTCACCACACCTCCGGTAACCAATATGTATTTCATTCTCGATCCTCTTT
JMFS147C10+ TCCCGAGCCCGCTCACCACACCTCCGGTAACCAATATGTATTTCATTCTCGATCCTCTTT
JMSF029A20+ TCCCGAGCCCGCTCACCACACCTCCGGTAACCAATATGTATTTCATTCTCGATCCTCTTT
                      ____________________________________________________________
consensus TCCCGAGCCCGCTCACCACACCTCCGGTAACCAATATGTATTTCATTCTCGATCCTCTTT
 
. : . : . : . : . : . :
JMFF032I19+ CTTCTCTGTACGTTTTTTTTATTTTTTAAATTTTCCGGTGAACAAAACCCCCTACCTGCA
JMFF010D14+ CTTCTCTGTACGTTTTTTTTATTTTTTAAATTTTCCGGTGAACAAAACCCCCTACCTGCA
JMFS147C10+ CTTCTCTGTACGTTTTTTTTATTTTTTAAATTTTCCGGTGAACAAAACCCCCTACCTGCA
JMSF029A20+ CTTCTCTGTACGTTTTTTTTATTTTTTAAATTTTCCGGTGAACAAAACCCCCTACCTGCA
                      ____________________________________________________________
consensus CTTCTCTGTACGTTTTTTTTATTTTTTAAATTTTCCGGTGAACAAAACCCCCTACCTGCA
 
. : . : . : . : . : . :
JMFF032I19+ ATTCTCGTAAACCACTGGAGCTGAGCTGAGTGACCAGAGGGGTCAAAAACGGAAAGCGCA
JMFF010D14+ ATTCTCGTAAACCACTGGAGCTGAGCTGAGTGACCAGAGGGGTCAAAAACGGAAAGCGCA
JMFS147C10+ ATTCTCGTAAACCACTGGAGCTGAGCTGAGTGACCAGAGGGGTCAAAAACGGAAAGCGCA
JMSF029A20+ ATTCTCGTAAACCACTGGAGCTGAGCTGAGTGACCAGAGGGGTCAAAAACGGAAAGCGCA
                      ____________________________________________________________
consensus ATTCTCGTAAACCACTGGAGCTGAGCTGAGTGACCAGAGGGGTCAAAAACGGAAAGCGCA
 
. : . : . : . : . : . :
JMFF032I19+ CCAAC
JMFF010D14+ CCAAC
JMFS147C10+ CCAACACTGTCTGCCACCGGGCCAGACCCGACCCTTATCCACTAAGCTCTATGTTTCCAG
JMSF029A20+ CCAACACTGTCTGCCACCGGGCCAGACCCGACCCTTATCCACTAAGCTCTATGTTTCCAG
                      ____________________________________________________________
consensus CCAACACTGTCTGCCACCGGGCCAGACCCGACCCTTATCCACTAAGCTCTATGTTTCCAG
 
. : . : . : . : . : . :
JMFS147C10+ GGAGCAGAGACGCAACAAAGAGACGTGTATACACGTGTGCTTGTATATCTATATATATGT
JMSF029A20+ GGAGCAGAGACGCAACAAAGAGACGTGTATACACGTGTGCTTGTATATCTATATATATGT
                      ____________________________________________________________
consensus GGAGCAGAGACGCAACAAAGAGACGTGTATACACGTGTGCTTGTATATCTATATATATGT
 
. : . : . : . : . : . :
JMFS147C10+ ATAGATATATGATATAGAAATATATAAATATAAAGAAGGAGAAGAAATGGATATGAGATG
JMSF029A20+ ATAGATATATGATATAGAAATATATAAATATAAAGAAGGAGAAGAAATGGATATGAGATG
                      ____________________________________________________________
consensus ATAGATATATGATATAGAAATATATAAATATAAAGAAGGAGAAGAAATGGATATGAGATG
 
. : . : . : . : . : . :
JMFS147C10+ AAGCAAATAGACACAGACGATGAAAACGTTGAGAGGATTGAAGAG
JMSF029A20+ AAGCAAATAGACACAGACGATGAAAACGTTGAGAGGATTGAAGAGAGGGAGACGGAGATC
                      ____________________________________________________________
consensus AAGCAAATAGACACAGACGATGAAAACGTTGAGAGGATTGAAGAGAGGGAGACGGAGATC