Previous Contig 006557:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS048C09Sequence613006557 (4)gb:AK176297_18182852e-32Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL23-
JMFS153A06Sequence620006557 (4)pir|G86162|G861622e-21protein F10O3.1 [imported] - Arabidopsis thaliana>gb:AE005172_889336 Arabidopsis
JMSF029A18Sequence658006557 (4)pir|G86162|G861621e-18protein F10O3.1 [imported] - Arabidopsis thaliana>gb:AE005172_889336 Arabidopsis657012633 (3)gb:AC105773_17382491e-17Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s
JMSF032M07Sequence685006557 (4)pir|G86162|G861622e-28protein F10O3.1 [imported] - Arabidopsis thaliana>gb:AE005172_889336 Arabidopsis751012633 (3)gb:AC105773_17382491e-27Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS048C09+ GCGGGTGTTTGTTCAATTCTTGCCACCAAAGGGAGAACCACTGACTCAGATTTC
JMSF032M07+ AACCACTGACTCAGATTTC
                      ____________________________________________________________
consensus GCGGGTGTTTGTTCAATTCTTGCCACCAAAGGGAGAACCACTGACTCAGATTTC
 
. : . : . : . : . : . :
JMFS048C09+ GTATCCAGCATTGTATTCCTAGCCACAATGGTAGGAAGACCTTGATCGGAGAGCAAAACC
JMFS153A06+ TGATCGGAGAGCAAAACC
JMSF032M07+ GTATCCAGCATTGTATTCCTAGCCACAATGGTAGGAAGACCTTGATCGGAGAGCAAAACC
                      ____________________________________________________________
consensus GTATCCAGCATTGTATTCCTAGCCACAATGGTAGGAAGACCTTGATCGGAGAGCAAAACC
 
. : . : . : . : . : . :
JMFS048C09+ CCACTGGCATTAACAGCGGCAGCAATATCAACACGTTCATCGACCAACAAGTAGGCTCTT
JMFS153A06+ CCACTGGCATTAACAGCGGCAGCAATATCAACACGTTCATCGACCAACAAGTAGGCTCTT
JMSF032M07+ CCACTGGCATTAACAGCGGCAGCAATATCAACACGTTCATCGACCAACAAGTAGGCTCTT
JMSF029A18+ ACTGGCATTAACAGCGGCAGCAATATCAACACGTTCATCGACCAACAAGTAGGCTCTT
                      ____________________________________________________________
consensus CCACTGGCATTAACAGCGGCAGCAATATCAACACGTTCATCGACCAACAAGTAGGCTCTT
 
. : . : . : . : . : . :
JMFS048C09+ TCGCGGATGACCGACTTCAACAAGCAGGCAGCCTCGTACAATTTCCCGCCGCTCACCCCA
JMFS153A06+ TCGCGGATGACCGACTTCAACAAGCAGGCAGCCTCGTACAATTTCCCGCCGCTCACCCCA
JMSF032M07+ TCGCGGATGACCGACTTCAACAAGCAGGCAGCCTCGTACAATTTCCCGCCGCTCACCCCA
JMSF029A18+ TCGCGGATGACCGACTTCAACAAGCAGGCAGCCTCGTACAATTTCCCGCCGCTCACCCCA
                      ____________________________________________________________
consensus TCGCGGATGACCGACTTCAACAAGCAGGCAGCCTCGTACAATTTCCCGCCGCTCACCCCA
 
. : . : . : . : . : . :
JMFS048C09+ CCGCCACTGAGCAACTCGATGCCGACCCGACCCGAGACCGCCTGATCTATCTCATCAAGG
JMFS153A06+ CCGCCACTGAGCAACACGATGCCGACCCGACCCGAGACCGCCTGATCTATCTCATCAAGG
JMSF032M07+ CCGCCACTGAGCAACACGATGCCGACCCGACCCGAGACCGCCTGATCTATCTCATCAAGG
JMSF029A18+ CCGCCACTGAGCAACACGATGCCGACCCGACCCGAGACCGCCTGATCTATCTCATCAAGG
                      ____________________________________________________________
consensus CCGCCACTGAGCAACACGATGCCGACCCGACCCGAGACCGCCTGATCTATCTCATCAAGG
 
. : . : . : . : . : . :
JMFS048C09+ ACGTTCCGATTATCGAAAACCTCTTGGGTGCTTAGCTGGAGCACGAGACTAGGAACTTTG
JMFS153A06+ ACGTTCCGATTATCGAAAACCTCTTGGGTGCTTAGCTGGAGCACGAGACTAGGAACTTTG
JMSF032M07+ ACGTTCCGATTATCGAAAACCTCTTGGGTGCTTAGCTGGAGCACGAGACTAGGAACTTTG
JMSF029A18+ ACGTTCCGATTATCGAAAACCTCTTGGGTGCTTAGCTGGAGCACGAGACTAGGAACTTTG
                      ____________________________________________________________
consensus ACGTTCCGATTATCGAAAACCTCTTGGGTGCTTAGCTGGAGCACGAGACTAGGAACTTTG
 
. : . : . : . : . : . :
JMFS048C09+ ATCTCCGGCCGCTTAAACCCACCGGGGAAGAGCGTCCGCGGCTGTTGCTTCGGTTGCTCC
JMFS153A06+ ATCTCCGGCCGCTTAAACCCACCGGGGAAGAGCGTCCGCGGCTGTTGCTTCGGTTGCTCC
JMSF032M07+ ATCTCCGGCCGCTTAAACCCACCGGGGAAGAGCGTCCGCGGCTGTTGCTTCGGTTGCTCC
JMSF029A18+ ATCTCCGGCCGCTTAAACCCACCGGGGAAGAGCGTCCGCGGCTGTTGCTTCGGTTGCTCC
                      ____________________________________________________________
consensus ATCTCCGGCCGCTTAAACCCACCGGGGAAGAGCGTCCGCGGCTGTTGCTTCGGTTGCTCC
 
. : . : . : . : . : . :
JMFS048C09+ TCATTATTGAACACTAAAGAGACATTACTGCGGTCGGCGGCGCGTACAGAGATGTTGGTG
JMFS153A06+ TCATTATTGAACACTAAAGAGACATTACTGCGGGCGGCGGCGCGTACAGAGATGTTGGTG
JMSF032M07+ TCATTATTGAACACTAAAGAGACATTACTGCGGGCGGCGGCGCGTACAGAGATGTTGGTG
JMSF029A18+ TCATTATTGAACACTAAAGAGACATTACTGCGGGCGGCGGCGCGTACAGAGATGTTGGTG
                      ____________________________________________________________
consensus TCATTATTGAACACTAAAGAGACATTACTGCGGGCGGCGGCGCGTACAGAGATGTTGGTG
 
. : . : . : . : . : . :
JMFS048C09+ CAACGAAGACGAGGCTTGAAGTGGGGAGGAGAGTAGTGGGATGGGGTTGGGGAGGCGAAG
JMFS153A06+ CAACGAAGACGAGGCTTGAAGTGGGGAGGAGAGTAGTGGGATGGGGTTGGGGAGGCGAAG
JMSF032M07+ CAACGAAGACGAGGCTTGAAGTGGGGAGGAGAGTAGTGGGATGGGGTTGGGGAGGCGAAG
JMSF029A18+ CAACGAAGACGAGGCTTGAAGTGGGGAGGAGAGTAGTGGGATGGGGTTGGGGAGGCGAAG
                      ____________________________________________________________
consensus CAACGAAGACGAGGCTTGAAGTGGGGAGGAGAGTAGTGGGATGGGGTTGGGGAGGCGAAG
 
. : . : . : . : . : . :
JMFS048C09+ GGCCAGTGTGAAGGAGAGTGAACGGAGCAGCA-TGAGAGAGTAAATATTCCATAGATAAG
JMFS153A06+ TGGCAGTGTGAAGGAGAGTGAACGGAGCAGCATTGAGAGAGTAAAGATACCATAGATAAG
JMSF032M07+ TGGCAGTGTGAAGGAGAGTGAACGGAGCAGCATTGAGAGAGTAAAGATACCATAGATAAG
JMSF029A18+ TGGCAGTGTGAAGGAGAGTGAACGGAGCAGCATTGAGAGAGTAAAGATACCATAGATAAG
                      ____________________________________________________________
consensus TGGCAGTGTGAAGGAGAGTGAACGGAGCAGCATTGAGAGAGTAAAGATACCATAGATAAG
 
. : . : . : . : . : . :
JMFS048C09+ TTGCTGGAGGTG
JMFS153A06+ TTGCTGGAGGTGTGGAAAAACACAGAATTCGACGGAGGCGGAAGCTGAGAGCGGCGGCGA
JMSF032M07+ TTGCTGGAGGTGTGGAAAAACACAGAATTCGACGGAGGCGGAAGCTGAGAGCGGCGGCGA
JMSF029A18+ TTGCTGGAGGTGTGGAAAAACACAGAATTCGACGGAGGCGGAAGCTGAGAGCGGCGGCGA
                      ____________________________________________________________
consensus TTGCTGGAGGTGTGGAAAAACACAGAATTCGACGGAGGCGGAAGCTGAGAGCGGCGGCGA
 
. : . : . : . : . : . :
JMFS153A06+ TGGTGGGGATAGGGGAGAAGAAAAATAGCCTTATGGCCTTATCTTATCTGAAATCTGTAA
JMSF032M07+ TGGTGGGGATAGGGGAGAAGAAAAATAGCCTTATGGCCTTATCTTATCTGAAATCTGTAA
JMSF029A18+ TGGTGGGGATAGGGGAGAAGAAAAATAGCCTTATGGCCTTATCTTATCTGAAATCTGTAA
                      ____________________________________________________________
consensus TGGTGGGGATAGGGGAGAAGAAAAATAGCCTTATGGCCTTATCTTATCTGAAATCTGTAA
 
. : . : . : . : . : . :
JMFS153A06+ TC
JMSF032M07+ TC
JMSF029A18+ TCTGTAATCTGCTACACAGTGGTGGACGGACAAATGAAATCGTGGAGCTAGAAGAGTTCC
                      ____________________________________________________________
consensus TCTGTAATCTGCTACACAGTGGTGGACGGACAAATGAAATCGTGGAGCTAGAAGAGTTCC