Previous Contig 006556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002J24Sequence294006556 (2)gb:BT015810_16424281e-10Arabidopsis thaliana At2g36070 gene, complete cds.759022034gb:BT015810_16424282e-59Arabidopsis thaliana At2g36070 gene, complete cds.
JMSF029A16Sequence640006556 (2)gb:BT015810_16424281e-33Arabidopsis thaliana At2g36070 gene, complete cds.735023367gb:BT015810_16424281e-56Arabidopsis thaliana At2g36070 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029A16+ ATTTGAGCTGCAACTGTCGGAGTTTACATTTGATCCTTCA
                      ____________________________________________________________
consensus ATTTGAGCTGCAACTGTCGGAGTTTACATTTGATCCTTCA
 
. : . : . : . : . : . :
JMSF029A16+ GAGTCTTGCTTCCCATACCCAAAAGTTTCTTTGACCTCTTCCTTAGCAGCAGAAACCTTT
                      ____________________________________________________________
consensus GAGTCTTGCTTCCCATACCCAAAAGTTTCTTTGACCTCTTCCTTAGCAGCAGAAACCTTT
 
. : . : . : . : . : . :
JMSF029A16+ TCCCCGACATTAGCATAAACCTTTTTTGCTGTAGATTCAGCCTCTGTCCAGACACCATCC
                      ____________________________________________________________
consensus TCCCCGACATTAGCATAAACCTTTTTTGCTGTAGATTCAGCCTCTGTCCAGACACCATCC
 
. : . : . : . : . : . :
JMSF029A16+ ACATGCTTGTAAAGCTGCTCAGTAGTCTGCTTTGTTCTTGCTTTTAGATCTTCTTTGACT
                      ____________________________________________________________
consensus ACATGCTTGTAAAGCTGCTCAGTAGTCTGCTTTGTTCTTGCTTTTAGATCTTCTTTGACT
 
. : . : . : . : . : . :
JMSF002J24+ ACTGACTGTTGGAATTCCTTGTTT
JMSF029A16+ CCTTGAAGCTCTTCTGCTTTATCTTTCAGTTCTTTGACTGACTGCTGAAATTCCTTGTTT
                      ____________________________________________________________
consensus CCTTGAAGCTCTTCTGCTTTATCTTTCAGTTCTTTGACTGACTGTTGGAATTCCTTGTTT
 
. : . : . : . : . : . :
JMSF002J24+ CTGTTAAACTCGCCTTTGAATTTCTGAGAGAACTCATTGAATACACTGAATTGGCGATTA
JMSF029A16+ CTGTTAACTTCACCTTTAAGTTTCTGAGAGAATTCATTGAATACACTGAATTGACGATTA
                      ____________________________________________________________
consensus CTGTTAACTTCGCCTTTGAGTTTCTGAGAGAATTCATTGAATACACTGAATTGGCGATTA
 
. : . : . : . : . : . :
JMSF002J24+ CCCGCGTAGCCATATGCCTGGACCAACCTTAAACTTGTTGCGCCTCT------ACCCACC
JMSF029A16+ CCCACGTAGCCATATGCCTGACCCAATCTCAAACTTGTTGCACCTCTGCTTGAAATCACC
                      ____________________________________________________________
consensus CCCGCGTAGCCATATGCCTGGCCCAATCTTAAACTTGTTGCGCCTCTGCTTGAACTCACC
 
. : . : . : . : . : . :
JMSF002J24+ TGCTGAGGTACTAATAGCTGATGGATAATGGGTCGTGTTTTGGAGAACAAAAAATCCCGA
JMSF029A16+ TGCTGAGGTACTAATAGCTGATGGAAAACGGGTTGTCTTTTGGAAAGCAAAAAATCTCGA
                      ____________________________________________________________
consensus TGCTGAGGTACTAATAGCTGATGGATAATGGGTTGTGTTTTGGAGAGCAAAAAATCTCGA
 
. : . : . : . : . : . :
JMSF002J24+ ACTAATTTTCTGCTAGCCATTGGAGGCTGCGGATGAATGTGG
JMSF029A16+ ACTAATTTTCTGCTGGCCATTGAAGTCCACGGATGAATGTGGCACGCATAATCCTATCCC
                      ____________________________________________________________
consensus ACTAATTTTCTGCTGGCCATTGGAGTCTGCGGATGAATGTGGCACGCATAATCCTATCCC
 
. : . : . : . : . : . :
JMSF029A16+ CTTCAAGCTTTCCACTTTCAACCAAAATTCTTCGGAAATATTGTTTTGAGGTGTCCAACT
                      ____________________________________________________________
consensus CTTCAAGCTTTCCACTTTCAACCAAAATTCTTCGGAAATATTGTTTTGAGGTGTCCAACT
 
. : . : . : . : . : . :
JMSF029A16+ GTGGACGTTGGAGATGGATGTTCTTACGAAAAATTGAAGAAATAACCCTAGATGCTACCC
                      ____________________________________________________________
consensus GTGGACGTTGGAGATGGATGTTCTTACGAAAAATTGAAGAAATAACCCTAGATGCTACCC