Previous Contig 006554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E01Sequence490006554 (5)sp|O22300|HKLB_LYCES5e-11Homeobox protein knotted-1 like LET12.>pir|T04318|T04318 homeobox protein LeT12,
JMSF006F18Sequence464006554 (5)164004809 (13)
JMSF029A10Sequence671006554 (5)sp|O22300|HKLB_LYCES5e-25Homeobox protein knotted-1 like LET12.>pir|T04318|T04318 homeobox protein LeT12,763013726 (4)gb:AY120762_15796449e-57Arabidopsis thaliana KNAT3 homeodomain protein (At5g25220) mRNA, complete cds.>g
JMSF042J21Sequence261006554 (5)717013726 (4)gb:AY120762_15796447e-52Arabidopsis thaliana KNAT3 homeodomain protein (At5g25220) mRNA, complete cds.>g
JMSF048G15Sequence641006554 (5)sp|O22300|HKLB_LYCES1e-30Homeobox protein knotted-1 like LET12.>pir|T04318|T04318 homeobox protein LeT12,829024309gb:LEU76409_16847623e-63Lycopersicon esculentum homeobox 1 protein (THox1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048G15+ TTGTTCTTTAAAGG
JMSF029A10+ TTCTTTAAAGG
                      ____________________________________________________________
consensus TTGTTCTTTAAAGG
 
. : . : . : . : . : . :
JMSF048G15+ AAGACAGCAACATAACATAATGTGTCATAAATTGATCAAGGTCTTTATCGTCTAGGGGAG
JMSF029A10+ AAGACAGCAACATAACATAANGNGTCATAAATTGATCAAGGTNTTNATNGTNTAGGGGAG
                      ____________________________________________________________
consensus AAGACAGCAACATAACATAATGTGTCATAAATTGATCAAGGTCTTTATCGTCTAGGGGAG
 
. : . : . : . : . : . :
JMSF048G15+ GTTGGGGGTGGGCGAGAAGGGAGGAGTAGTTAGCGACGACGTTTTGGGACTGAGCAAGCT
JMSF029A10+ GTNGGGGGTGGGCGAGAAGGGAGGAGTAGTTAGNGANGACGTTTTGGGANTGAGCAAGCT
                      ____________________________________________________________
consensus GTTGGGGGTGGGCGAGAAGGGAGGAGTAGTTAGCGACGACGTTTTGGGACTGAGCAAGCT
 
. : . : . : . : . : . :
JMSF048G15+ GGGCGTCGATTCTGGGGAGCTGGTCAACGGGCGTGGCGATTCTGAGGCAGGACACGTGAG
JMFF008E01+ TGAGGCAGGACACGTGAG
JMSF029A10+ GGGNGTNGATTNTGGGGAGNTGGTCAACGGGCGTGGNGATTNTGAGGCAGGACACGTGAG
                      ____________________________________________________________
consensus GGGCGTCGATTCTGGGGAGCTGGTCAACGGGCGTGGCGATTCTGAGGCAGGACACGTGAG
 
. : . : . : . : . : . :
JMSF048G15+ CCGACAGCAATTGATCGTAGAGAGGGTGGTTCAGAAGGTCGGCCTTGCACTTCTCCCTCA
JMFF008E01+ CNGACAGCAATTGATNGTAGAGAGGGTGGTTCAGAAGGTCGGCCTTGCACTTCTCCCTCA
JMSF006F18+ GACAGCAATTGATNGTAGAGAGGGTGGTTCAGAAGGTNGGCCTTGCANTTNTCCCTCA
JMSF029A10+ CCGACAGCAATTGATNGTAGAGAGGGTGGTTCAGAAGGTCGGCCTTGCACTTCTCCCTCA
                      ____________________________________________________________
consensus CCGACAGCAATTGATCGTAGAGAGGGTGGTTCAGAAGGTCGGCCTTGCACTTCTCCCTCA
 
. : . : . : . : . : . :
JMSF048G15+ CCCAACTACTACTACTACTGCTCCCTCCTGCGCCTTCGAATTCGCCTTCACCGTGCTTCT
JMFF008E01+ CCCAANTANTANTACTACTGCTCCCTCNTGCGCCTTNGAATTCGCCTTCACCGTGNTTNT
JMSF006F18+ CCCAANTANTANTANTANTGNTCCNTCNTGNGCNTTNGAATTNGCNTTCACCGTGNTTNT
JMSF042J21+ TCGCCTTCACCGTGCTTCT
JMSF029A10+ CCCAANTANTANTACTANTGCTCCNTCNTGCGCCTTNGAATTCGCCTTCACCGTGCTTCT
                      ____________________________________________________________
consensus CCCAACTACTACTACTACTGCTCCCTCCTGCGCCTTCGAATTCGCCTTCACCGTGCTTCT
 
. : . : . : . : . : . :
JMSF048G15+ TAACGTCGGCGGTGGGAGACAGCCAGTTGGTGGAGGAGTCGGAGTTGTTGTTGTTGGAGG
JMFF008E01+ TAACGTCGGCGGTGGGAGACAGCCAGTTGGTGGAGGAGTNGGAGTTGTTGTTGTNGGAGG
JMSF006F18+ TAANGTNGGCGGTGGGAGACAGCCAGTTGGTGGAGGAGTCGGAGTTGTTGTTGTTGGAGG
JMSF042J21+ TAACGTCGGCGGTGGGAG--AGCCAGTTGGTGGAGGAGTCGGAGTTGTTGTTGTTGGAGG
JMSF029A10+ TAACGTCGGCGGTGGGAGACAGCCAGTTGGTGGAGGAGTCGGAGTTGTTGTTGTTGGAGG
                      ____________________________________________________________
consensus TAACGTCGGCGGTGGGAGACAGCCAGTTGGTGGAGGAGTCGGAGTTGTTGTTGTTGGAGG
 
. : . : . : . : . : . :
JMSF048G15+ TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
JMFF008E01+ TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
JMSF006F18+ TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
JMSF042J21+ TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
JMSF029A10+ TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
                      ____________________________________________________________
consensus TTTGGAGGTGGAGGAAGTTGGAATTATTATTGGGGGAGTCGGAGAAGTGGTGGTGGCGCT
 
. : . : . : . : . : . :
JMSF048G15+ GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
JMFF008E01+ GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
JMSF006F18+ GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
JMSF042J21+ GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
JMSF029A10+ GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
                      ____________________________________________________________
consensus GCAGGCGGAGGAAGACGGAGGTGGAAGGCGGAGGAGATTTTGGAGAAGGAGAAGGCTGGT
 
. : . : . : . : . : . :
JMSF048G15+ CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
JMFF008E01+ CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
JMSF006F18+ CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
JMSF042J21+ CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
JMSF029A10+ CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
                      ____________________________________________________________
consensus CCGGTAGCATAGACCGCAAAACGCCCGCGTTTTGCTGCTGCTCGACGCCCATTTCTTCAG
 
. : . : . : . : . : . :
JMSF048G15+ AAAACTGATCCTCAAACATAATACACCACCACCACCTTCTACTCTCTACTCCACCATACA
JMFF008E01+ AAAACTGATCCTCAAACATAATACACCACCACCACCTTCTACTCTCTACTCCACCATACA
JMSF006F18+ AAAACTGATCCTCAAACATAATACACCACCACCACCTTCTACTCTCTACTCCACCATACA
JMSF042J21+ AAAA
JMSF029A10+ AAAACTGATCCTCAAACATAATACACCACCACCACCTTCTACTCTCTACTCCACCATACA
                      ____________________________________________________________
consensus AAAACTGATCCTCAAACATAATACACCACCACCACCTTCTACTCTCTACTCCACCATACA
 
. : . : . : . : . : . :
JMSF048G15+ CTACGTTAGTTAGTTGTTTTTGTTTT
JMFF008E01+ CTACGTTAGTTAGTTGTTTTTGTTTTTTAAAACACATGCCATCTC
JMSF006F18+ CTACGTTAGTTAGTTGTTTTTGTTTTTTAAAACACATGCCATCTC
JMSF029A10+ CTACGTTAGTTAGTTGTTTTTGTTTTTTAAAACACATGCCATCTCATCCCACTATTTATC
                      ____________________________________________________________
consensus CTACGTTAGTTAGTTGTTTTTGTTTTTTAAAACACATGCCATCTCATCCCACTATTTATC