Previous Contig 006549:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034M11Sequence491006549 (5)gb:AY830138_16293381e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.734009832 (4)
JMFS023F02Sequence604006549 (5)gb:AY830138_16293384e-06Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMSF021P15Sequence685006549 (5)gb:AY830138_16293380.003Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.720009832 (4)
JMSF022K13Sequence671006549 (5)gb:AY830138_16293382e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.741009832 (4)gb:AX076881_14606692e-05Sequence 2 from Patent WO0107635.>gb:AX076883_1460670 Sequence 4 from Patent WO0
JMSF028O10Sequence625006549 (5)gb:AY830138_16293384e-07Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.615009832 (4)gb:SAC249448_17046705e-16Solanum acaule Rx2.ac15 gene for NBS-LRR protein, exons 1-3.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021P15+ AATGGAGACAATTTCTCGTTGCCNTGATGAATGCTGAATTAGCAT
                      ____________________________________________________________
consensus AATGGAGACAATTTCTCGTTGCCNTGATGAATGCTGAATTAGCAT
 
. : . : . : . : . : . :
JMSF021P15+ CGCCTTTACAATCTGGAACTCGTTGTTTTTCCCCACCATTATGCTGCCCTGCTGGGGCTG
                      ____________________________________________________________
consensus CGCCTTTACAATCTGGAACTCGTTGTTTTTCCCCACCATTATGCTGCCCTGCTGGGGCTG
 
. : . : . : . : . : . :
JMSF021P15+ GGAGTGTGAAGCGTGTTGGCGGTGGGAGGAAGCTGCGGCTGCGGCAAGTACTGTAGTTGT
                      ____________________________________________________________
consensus GGAGTGTGAAGCGTGTTGGCGGTGGGAGGAAGCTGCGGCTGCGGCAAGTACTGTAGTTGT
 
. : . : . : . : . : . :
JMSF021P15+ TGTTTTCCTTCCAATTCCAATTCCTTGCAAGGCGGCTGCGACACACTCCATCTTCTCTTT
                      ____________________________________________________________
consensus TGTTTTCCTTCCAATTCCAATTCCTTGCAAGGCGGCTGCGACACACTCCATCTTCTCTTT
 
. : . : . : . : . : . :
JMSF021P15+ GGACAAGTCTTTGTGGATGGCATCAATGTCTCTTATTGCTCCTTCCAAAATACAACCAAG
JMSF028O10+ TGCTCCTTTCAAAATACAACCAAG
                      ____________________________________________________________
consensus GGACAAGTCTTTGTGGATGGCATCAATGTCTCTTATTGCTCCTTTCAAAATACAACCAAG
 
. : . : . : . : . : . :
JMSF021P15+ TTTCAAAGAATGCGAAGTTTCTCCTGCTTGTGGTTTTTCCACAAAAAGATCTGCAGCAAT
JMFF034M11+ AGTTTCTCCTGCTTGTGGTTTTTCCACAAAAAGATCTGCAGCAAT
JMSF022K13+ AGTTTCTCCTGCTTGTGGTTTTTCCACAAAAAGATCTGCAGCAAT
JMFS023F02+ AGTTTCTCCTGATTGTGGTTTTTCCACAAAAAGATCTGCAGCAAT
JMSF028O10+ TTTCAAAGAATGCGAAGTTTCTCCTGCTTGTGGTTTTTCCACAAAAAGATTTGCAGCAAT
                      ____________________________________________________________
consensus TTTCAAAGAATGCGAAGTTTCTCCTGCTTGTGGTTTTTCCACAAAAAGATCTGCAGCAAT
 
. : . : . : . : . : . :
JMSF021P15+ TCCCAAGTCTTCTTC---TTCTGCATCAATAGTCCTTTGTGGTTTTTCTCCAAAAAGACC
JMFF034M11+ TCCCAAGTCTTCTTC---TTCTGCATCAATAGTCCTTTGTGGTTTTTCTCCAAAAAGACC
JMSF022K13+ TCCCAAGTCTTCTTC---TTCTGCATCAATAGTCCTTTGTGGTTTTTCTCCAAAAAGACC
JMFS023F02+ TCCCAAGTCTTCTTC------TGCGTCAATAGTCCTCTGGGGGTTTTCCAAAAAAAGACC
JMSF028O10+ TTCCAAGTCGTCTTCNTCTTNTGCATCATTAGTCCTCTGTGGGTTTTCCCCAAAAAGACC
                      ____________________________________________________________
consensus TCCCAAGTCTTCTTC---TTCTGCATCAATAGTCCTTTGTGGTTTTTCTCCAAAAAGACC
 
. : . : . : . : . : . :
JMSF021P15+ TGCTATTGCTGCTAATAACTCTCCCTCTTCCTCTTCCTCATAAAGATGTAGGATTTGGAA
JMFF034M11+ TGCTATTGCTGCTAATAACTCTCCCTCTTCCTCTTCCTCATAAAGATGTAGGATTTGGAA
JMSF022K13+ TGCTATTGCTGCTAATAACTCTCCCTCTTCCTCTTCCTCATAAAGATGTAGGATTTGGAA
JMFS023F02+ TGCTATTCCTGCAAGTAACTCTTCCATTTCCTCTATCTCATAAAGATGTACGATTTGGAA
JMSF028O10+ TGCTATTGCTGCTAATAACTCTTCCTCTTCCTCTTCCTCATAAAGATGTACGATTTGGAA
                      ____________________________________________________________
consensus TGCTATTGCTGCTAATAACTCTCCCTCTTCCTCTTCCTCATAAAGATGTAGGATTTGGAA
 
. : . : . : . : . : . :
JMSF021P15+ TTCAATTTCGTCTTCCACTCGGAAAGCCACATCTCTGAGCTTAGTTTCCAAGTGTTTAAT
JMFF034M11+ TTCAATTTCGTCTTCCACTCGGAAAGCCACATCTCTGAGCTTAGTTTCCAAGTGTTTAAT
JMSF022K13+ TTCAATTTCGTCTTCCACTCGGAAAGCCACATCTCTGAGCTTAGTTTCCAAGTGTTTAAT
JMFS023F02+ TTCAATTTCATCTTCTACTCTGAAAGCCACGTCTCTGAGCTTAGTTTCCAAGTCTTTAAT
JMSF028O10+ TTCAATTTCATCTTCCACTCTGAAAGCCACATCTCTGAGCTTAGTTTCCAAGTCTTTAAT
                      ____________________________________________________________
consensus TTCAATTTCGTCTTCCACTCGGAAAGCCACATCTCTGAGCTTAGTTTCCAAGTGTTTAAT
 
. : . : . : . : . : . :
JMSF021P15+ AGCTTGGATATCATCCATCCTGTTCTCATCGAACAGATCTATGAGATCACCAAGCTTCTG
JMFF034M11+ AGCTTGGATATCATCCATCCTGTTCTCATCGAACAGATCTATGAGATCACCAAGCTTCTG
JMSF022K13+ AGCTTGGATATCATCCATCCTGTTCTCATCGAACAGATCTATGAGATCACCAAGCTTCTG
JMFS023F02+ AGCTTGGATACCATCCATCCTGTTCTCATCGAACAGCTCTATCAGATCACCAAGTTTCTG
JMSF028O10+ AGCTTGGATACCATCCATCCGGTTCTCATCGAACACCTCTATCAGATCACCAAGCTTCTG
                      ____________________________________________________________
consensus AGCTTGGATATCATCCATCCTGTTCTCATCGAACAGATCTATGAGATCACCAAGCTTCTG
 
. : . : . : . : . : . :
JMSF021P15+ GTGGAGATTTTGGATCAAGTTTTCATTGGCAGGGATGAGTTGGCTTTGTCGTACGATTGG
JMFF034M11+ GTGGAGATTTTGGATCAAGTTTTCATTGGCAGGGATGAGTTGGCTTTGTCGTACGATTGG
JMSF022K13+ GTGGAGATTTTGGATCAAGTTTTCATTGGCAGGGATGAGTTGGCTTTGTCGTACGATTGG
JMFS023F02+ GTGGAGGTTTTGGATCAAGTTTTTATTGGCAGGGATGAGTTGCTTTTGTCGTACGATTGG
JMSF028O10+ ATGGAGATTTTGGATAAACTTTTCATTGCCAGGGATGAGCTGCTTTCGTCGTACGATTGG
                      ____________________________________________________________
consensus GTGGAGATTTTGGATCAAGTTTTCATTGGCAGGGATGAGTTGGCTTTGTCGTACGATTGG
 
. : . : . : . : . : . :
JMSF021P15+ GCGAGGCAGAGGTTGCAAGAACTCAAGCTCAATCGTCCTCAC
JMFF034M11+ GCGAGGCAGAGGTTGCAAGAACTCAAGCTCAATCGTCCTCACAAGAGAATTTACAGCAAC
JMSF022K13+ GCGAGGCAGAGGTTGCAAGAACTCAAGCTCAATCGTCCTCACAAGAGAATTTACAGCAAC
JMFS023F02+ GCGAGGCAGAGGTTGCAACAACTCAAGCTCAATCGTCCTCACAAGAGAATTTACAGCAAC
JMSF028O10+ GCGAGGCAGAGGTTGCAAGAACTCAAGCTCAATGGTCCTCACAAGAGAATTAACAGCAAC
                      ____________________________________________________________
consensus GCGAGGCAGAGGTTGCAAGAACTCAAGCTCAATCGTCCTCACAAGAGAATTTACAGCAAC
 
. : . : . : . : . : . :
JMFF034M11+ ACAAGCCAT
JMSF022K13+ ACAAGCCAT
JMFS023F02+ ACAAGCCATTCTTCAATTC
JMSF028O10+ ACAAGCCATTCTACAATTCTCGACCACTTAGTATGTATGTATGTATGTAGTGCGTATAGT
                      ____________________________________________________________
consensus ACAAGCCATTCTTCAATTCTCGACCACTTAGTATGTATGTATGTATGTAGTGCGTATAGT
 
. : . : . : . : . : . :
JMSF028O10+ AATGTAATGTGATGTTTGGGTGAAGAATTGAAGCTTAATCAGCAGAACAAGAAGTAGCAA
                      ____________________________________________________________
consensus AATGTAATGTGATGTTTGGGTGAAGAATTGAAGCTTAATCAGCAGAACAAGAAGTAGCAA
 
. : . : . : . : . : . :
JMSF028O10+ TTGCTGTGTAGCTCTGCTCAGNGGAAATGCAATAATCGGAAGACTTTTCTGATAGACTCC
                      ____________________________________________________________
consensus TTGCTGTGTAGCTCTGCTCAGNGGAAATGCAATAATCGGAAGACTTTTCTGATAGACTCC