Previous Contig 006548:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS081C02Sequence619006548 (2)gb:AE016959_10236223e-73Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF028N23Sequence665006548 (2)gb:AE016959_10236224e-68Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09613023356

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS081C02+ TATCCATTTCAACTTTGTGCTGTGTCTGC
JMSF028N23+ TCTGC
                      ____________________________________________________________
consensus TATCCATTTCAACTTTGTGCTGTGTCTGC
 
. : . : . : . : . : . :
JMFS081C02+ ATACAGGAGCAAACCGTGCAGGTAACCATGTCCGAAAGGCAATTCAATATCTGAGACAGT
JMSF028N23+ ATACAGGAGCAAACCGTGCAGGTAACCATGTCCGAAAGGCAATTCAATATCTGAGACAGT
                      ____________________________________________________________
consensus ATACAGGAGCAAACCGTGCAGGTAACCATGTCCGAAAGGCAATTCAATATCTGAGACAGT
 
. : . : . : . : . : . :
JMFS081C02+ TCTCTAAGTTCGTCACTTCCAAGAATGCAAGCAATGCAGCTACATATGCATGCCAGCTGC
JMSF028N23+ TCTCTAAGTTCGTCACTTCCAAGAATGCAAGCAATGCAGCTACATATGCATGCCAGCTGC
                      ____________________________________________________________
consensus TCTCTAAGTTCGTCACTTCCAAGAATGCAAGCAATGCAGCTACATATGCATGCCAGCTGC
 
. : . : . : . : . : . :
JMFS081C02+ TGGAGACAGATCATGAATCCAATTATGCAATTATCACACTGTGTTGTCTGTATGTTGAAC
JMSF028N23+ TGGAGACAGATCATGAATCCAATTATGCAATTATCACACTGTGTTGTCTGTATGTTGAAC
                      ____________________________________________________________
consensus TGGAGACAGATCATGAATCCAATTATGCAATTATCACACTGTGTTGTCTGTATGTTGAAC
 
. : . : . : . : . : . :
JMFS081C02+ TCATCTTGTAACATAAAGCGTGTTGAAGCAACTGAATTCGCAAAGCAACAAAAAACCTCT
JMSF028N23+ TCATCTTGTAACATAAAGCGTGTTGAAGCAACTGAATTCGCAAAGCAACAAAAAACCTCT
                      ____________________________________________________________
consensus TCATCTTGTAACATAAAGCGTGTTGAAGCAACTGAATTCGCAAAGCAACAAAAAACCTCT
 
. : . : . : . : . : . :
JMFS081C02+ GTGCAAAGACAAAGTTCAGGGCAATGACTTTCTCCACATCGACCACTGCAAGGCATATAT
JMSF028N23+ GTGCAAAGACAAAGTTCAGGGCAATGACTTTCTCCACATCGACCACTGCAAGGCATATAT
                      ____________________________________________________________
consensus GTGCAAAGACAAAGTTCAGGGCAATGACTTTCTCCACATCGACCACTGCAAGGCATATAT
 
. : . : . : . : . : . :
JMFS081C02+ CCCCCACAGCATATGTATCTAGACATATCATTATAAAGAGCTCGCTTGCGCAGGAGATAT
JMSF028N23+ CCCCCACAGCATATGTATCTAGACATATCATTATAAAGAGCTCGCTTGCGCAGGAGATAT
                      ____________________________________________________________
consensus CCCCCACAGCATATGTATCTAGACATATCATTATAAAGAGCTCGCTTGCGCAGGAGATAT
 
. : . : . : . : . : . :
JMFS081C02+ GAGGCACATGGACCACAACAAACAGAGAAACAACAATAGAGAGGATCTGCCAATGGGGCA
JMSF028N23+ GAGGCACATGGACCACAACAAACAGAGAAACAACAATAGAGAGGATCTGCCAATGGGGCA
                      ____________________________________________________________
consensus GAGGCACATGGACCACAACAAACAGAGAAACAACAATAGAGAGGATCTGCCAATGGGGCA
 
. : . : . : . : . : . :
JMFS081C02+ CTCATGAGATCGGTGTGCCAGAAGTTGCGGTAGCTCTTCCGAGCCTGCATTTTCTGCATA
JMSF028N23+ CTCATGAGATCGGTGTGCCAGAAGTTGCGGTAGCTCTTCCGAGCCTGCATTTTCTGCATA
                      ____________________________________________________________
consensus CTCATGAGATCGGTGTGCCAGAAGTTGCGGTAGCTCTTCCGAGCCTGCATTTTCTGCATA
 
. : . : . : . : . : . :
JMFS081C02+ TACTCCTCGCTCGCCATTGTTCGACAAAATTGCGCCCCGTATCACAGAGTTAAGAATCCG
JMSF028N23+ TACTCCTCGCTCGCCATTGTTCGACAAAATTGCGCCCCGTATCACAGAGTTAAGAATCCG
                      ____________________________________________________________
consensus TACTCCTCGCTCGCCATTGTTCGACAAAATTGCGCCCCGTATCACAGAGTTAAGAATCCG
 
. : . : . : . : . : . :
JMFS081C02+ ATATCTGTTCCGCTCGGAAAAACGCAATAAACACGACAGTGTGCAATTCT
JMSF028N23+ ATATCTGTTCCGCTCGGAAAAACGCAATAAACACGACAGTGTGCAATTCTGCGTGCTTGC
                      ____________________________________________________________
consensus ATATCTGTTCCGCTCGGAAAAACGCAATAAACACGACAGTGTGCAATTCTGCGTGCTTGC
 
. : . : . : . : . : . :
JMSF028N23+ CTTGAACGCCTATATTATTCTATGTATTTTTACGTACTGTTTCTCCAATAATTCTCCGTC
                      ____________________________________________________________
consensus CTTGAACGCCTATATTATTCTATGTATTTTTACGTACTGTTTCTCCAATAATTCTCCGTC